Saturday, March 14, 2020
Identification of Human Parechovirus in clinical samples Essays
Identification of Human Parechovirus in clinical samples Essays Identification of Human Parechovirus in clinical samples Essay Identification of Human Parechovirus in clinical samples Essay Introduction The viral genus Parechovirus belongs to the household of Picornaviridae which are non- enveloped, plus strand, RNA viruses. Human Parechovirus and Ljungan virus are the two species belong to this genus. The Ljungan viruses are virus of gnawers, were isolated from bank field mouses in Sweden from a patient infected with myocardial inflammation. It portions similarity with Human Parechoviruses. The Human Parechovirus consists of 14 genotypes: HPeV-1 to HPeV-14. The HPeV-1 undergoes recombination with other strains to bring forth the diverseness in Parechoviruses. The viruses are 7100 to 8500 bases long which are enclosed in an icosahedral mirid bug made up of 60 transcripts each of mirid bug proteins VP1 to VP4. Once the HPeV1 and HPeV2 were known as echovirus 22 and 23 severally. HPeV2 has 87.9 % aminoacid individuality with HPeV1 genotype. Both were foremost stray in1956 during an epidermic of summer diarrhea. The genome has four distant spheres. The 5 untranslated part ( UTR ) precedes a individual unfastened reading frame, towards downstream there is a 3untranslated part and a poly ( A ) tail. The genome encoding a individual protein is processed by many virus encoded enzymes which produces precursors that map in virus reproduction to bring forth protein eventually. Figure 1: The genome of Picorna virus with conventional representation of poly protein in Parecho virus. The peptide covalently bound to 5end. The perpendicular pointers indicate the virus encoded activities for processing proteins. The places of VP0, VP3 and VP1 are indicated as 0, 3, and 1 in the polyprotein severally ( Beginning: Stanway, G.et Al ( 1999 ) Parechoviruses.Journal of Virology, 73, 5249-5254 ) . In general, all Picorna viruses have same basic genomic organisation, but different genotypes show specific features in 5UTR construction, L and 2Aproteins and 3UTR. There exists similarity in 5UTR of Parechovirus with cardio, aphtho viruses which reflects recombinant events occurred in the development of parechoviruses. ( Stanway, G. et Al, ( 1998 ) Molecular analysis of human Parechovirus 2, Journal of General virology, 79,2641-2650 ) The Parechovirus shows assorted responses in host cells. The cleavage of mirid bug protein VP0 seen in other Picorna viruses are non found in Parechovirus. It has a alone extension at N-terminal of mirid bug protein, VP3 and 2A protein which is extremely basic in character. ( Stanway, G. et Al, ( 2000 ) Human parechoviruses- biological science and clinical significance, Reviews in Medical Virology,10,57-69. ) Many recent surveies shown that the Parechoviruses are holding high rate of pathogenicity which causes stomach flu, respiratory unwellness, feverish unwellness, skin eruption, manus, pes and oral cavity disease , sterile meningitis, herpangia. The more prevalence of Parechovirus infections are found in kids less than 3 old ages. Harmonizing to a research done by Miyabi Ito.et Al on clinical stool samples from a random population in Aichi, Japan suggests that the base and aminoacid sequence of Nipponese HPeV-3 was similar to that found in Canada and Netherlands. The survey confirms the world-wide prevalence of Human Parechovirus infection. Besides they concluded that 97 % of patients were younger than 3 old ages old, and among them 86.2 % were under 12 months old. The finding of nucleotide sequence and phyletic analysis of VP1 part and 5UTR part revealed that bulk were holding HPeV1 infection, so comes HPeV3, so HPeV4 and eventually less figure with HPeV6. They besides found some seasonal fluctuation act uponing the clinical manifestation of Parechovirus. HPeV1 detected preponderantly during autumn and winter while HPeV3 instances detected in summer and autumn. They came to a decision that there are differences in mechanism of pathogenesis between HPeV1 and HPeV3 infections. ( Miyabi Ito et Al ( 2010 ) Detection of Human Parecho virus in clinical stool samples in Aichi, Japan, Journal of Clinical Microbiology, 48, 2683-2688 ) Based on the survey of the antigenic belongingss of human Parechoviruses done by Paivi Joki Korpela. et Al, they identified the antigenic site is within VP0 polypeptide. In HPeV1 the antigenisity is in the C-terminal part. The immunological features of HPeV1 mirid bug protein was besides found out utilizing the peptide scanning techniques. ( Korpela, P.J et Al ( 2000 ) Antigenic belongingss of human parechovirus1, Journal of General Virology, 81, 1709-1718 ) Surveies reveal that HPeV infects the cardinal nervous system ( CNS ) in kids associated with terrible neonatal sepsis like unwellness, meningitis or palsy. A group of scientists under the counsel of S.Rangraj has done surveies on HPeV-CNS infection in United States. This was the first multiyear prevalence study of HPeV-CNS infection in United States. They have isolated nucleic acid from cerebrospinal fluid of kids around the Kansas City for 3 old ages 2006 to 2008. HPeV RT-PCR was used and surveies done by sequencing VP3/VP1 junction. They could observe the HPeV in 7 % cerebrospinal fluid samples taken from patients, and the sensing was seasonal from June to October. HPeV3-CNS infection was found in 71 % of male babies. Most common clinical symptoms were sepsis like unwellness ( 66 % ) , crossness ( 98 % ) , fever ( 95 % ) and non-specific roseolas ( 58.6 % ) . ( Rangaraj.S et al ( 2010 ) Human parechovirus3 doing sepsis like unwellness in kids from Midwestern United States, The Ped iatric Infections Disease Journal, www.journals.iww.com ) The prevalence of world-wide pathogenesis shown by Parechovirus is obviously proved by Pham et al by making the research in 362 fecal samples for the sensing of HPeV types in one twelvemonth 2005 to 2006. They have done the survey in many kids who got infected with stomach flu in Srilanka. Out of 362 samples, 30 were positive with HPeV ( 8.3 % ) .The genotypes isolated were HPeV1, 3,4,5,10,11. ( Pham.N.T.K et al ( 2010 ) Human Parechovirus infection in kids hospitalized with acute stomach flu in Srilanka, Journal of clinical microbiology, www.mdlinx.com ) . The viral RNA reproduction composite in HPeV1 septic cells would incorporate the viral protein and membrane changes. The structural alterations in virus septic cells include the Golgi setup decomposition and loss of ribosomes from endoplasmic Reticulum. The viral plus strand RNA and 2C viral proteins were found as bunchs of little cysts in cells. The membrane adhering belongingss of protein 2C resulted in the determination of its presence in Golgi setup and endoplasmic Reticulum. HPeV1 reproduction composite is formed by Golgi marker cysts forms a alone construction among other Picorna viruses. ( Krogerus.C et.al ( 2003 ) Replication composite of human Parechovirus 1, Journal of Virology, 77, 8512-8523 ) In this survey, the clinical sample from a kid with mild diarrhea is taken which is analysed utilizing assorted molecular techniques, in peculiar RT-PCR. The survey included the sensing and analysis of viral RNA, surmising it as HPeV by naming the particular symptoms shown by the patient. The RT-PCR is done by utilizing HPeV specific primers OL993A and OL994A. It is followed by sequencing DNA commercially in both orientations utilizing Gene service.T7 and SP6 RNA polymerase written text induction sites of pGEM ( R ) -T Easy vector is used for this intent. The Analysis of DNA sequence is done farther utilizing Bioinformatics tools. It offers a speedy method of observing Parechovirus and placing which of its genotype is present in the clinical sample. Materials and Methods All the molecular methods were done on the footing of protocol given in Stanway, G. ( 2009 ) Practical Handbook. The RNA being isolated from the clinical sample utilizing commercial kit, QIA A ( R ) viral RNA mini kit produced by Qiagen. The kit works on the rule of selective binding belongingss of silicon oxide gel. ( hypertext transfer protocol: //www1.qiagen.com/products/rnastabilizationpurification/cellviralrnapurificationsystems/qiaampviralrnaminikit.asp ) . The RT-PCR has done along with negative control and marker DNA ( supplied by Invitrogen ) . Two primers OL993A and OL994A were used that are complimentary to the 3end of sense and anti sense strands of DNA, along with RT/PlatinumR Taq polymerase mix. The competent E.coli cells were transformed by utilizing the RT-PCR DNA and pGEM R-T Easy vector. The samples were spread to selective home bases incorporating Luria Bertani Broth. The plasmid DNA isolation was done with commercial kit, Qiagen QIA spin mini column and EcoR1 limitation digestion. The sample was so commercially sequenced utilizing Geneservice. The analysis of DNA sequence has been done with Blast plan ( hypertext transfer protocol: //www.ncbi.nlm.nih.gov/BLAST ) and alignment with Clustalw plan ( hypertext transfer protocol: //www.ebi.ac.uk/tools/clustalw/index.html ) . ( Stanway, G. ( 2009 ) BS934 Practical Handbook- Molecular Medicine Pathway ) Consequence Isolation of RNA from clinical sample: RNA set Deoxyribonucleic acid marker set Figure 2: The Agarose gel cataphoresis exposure of stray RNA sample. The RNA was isolated utilizing Qiagen viral RNA isolation kit. The cataphoresis was done along with DNA marker ( 1kb ladder supplied by Invitrogen ) and visualized the RNA set utilizing gel certification equipment. The RNA stuff was seen as a vilification on the Agarose gel. RT-PCR Deoxyribonucleic acid: Negative Control RT-PCR merchandise Deoxyribonucleic acid Marker Figure 3: The exposure of Ethidium bromide stained RT-PCR DNA after Agarose gel cataphoresis. As per the protocol given in Stanway, G. ( 2009 ) Practical Handbook, the RT-PCR has done along with negative control and marker DNA ( supplied by Invitrogen ) . It is found out that the RT-PCR DNA set has been visualised utilizing gel certification equipment. The presence of set confirmed the presence of HPeV in the clinical sample. There was no set seen in the negative control demoing the echt consequence without any kind of taint. The approximative size of the merchandise is obtained by comparing with the 1kb size criterion DNA marker set. RT-PCR calibrated secret plan for finding the molecular weight of DNA sample: Distance migrated by unknown DNA sample= 37mm Figure 4: The graph between the molecular weight of DNA marker and the distance migrated in the gel cataphoresis. The unknown molecular weight of the RT-PCR sample is calculated from the graph ( fig: 4 ) which was migrated to a distance of 37mm was found to be about 1000 bp ( reverse log 3 ) . Final gel consequence: 1 2 3 4 Figure5: The Agarose gel exposure obtained in 2010 practical. In the fig: 5, the sets were obtained for the RT-PCR DNA and EcoR1cut DNA from white settlement ( Lane 2 and 4 severally ) . There was no set formed for the EcoR1 cut DNA from the blue settlement ( Lane 3 ) . Deoxyribonucleic acid marker RT-PCR Deoxyribonucleic acid from white settlement EcoR1 cut DNA from bluish settlement EcoR1 cut DNA from white settlement Figure 6: The Agarose gel exposure from 2009 practical for comparative survey. The set formed by EcoR1 cut DNA from bluish settlement can be seen. Multiple sequence alliance of DNA sample utilizing Clustalw plan: HPeV1 GAAGATGACACAGAAAATTGCAAACAAACAATGTC-TCCAAATGAACTAGGACTCACTTC 59 HPeV6 GAGGATGATGCTGAAAACTGTAAACAAACAATATC-CCCAAATGAATTGGGTTTAACGTC 59 Consensus -GAATCTGCAGAAGAATGTAAACAGACAATATCACCCAAATGAATTGGGATTAACATC 57 HPeV4 GATGATTGCACTGAAGATTGCAAACAGACTATTTC-CCCAGATGAACTGGGTCTAACTTC 59 HPeV5 GATGATGAAGCTGAGGATTGTAAACAAACTATATC-TCCTGATGAACTAGGTCTTACCTC 59 HPeV2 GAAGATTCAGTAGAAGATTGTAAGCAAACCATTAC-ACCAACAGAATTGGGACTAACCTC 59 HPeV7 GAGGATTGTACTGAGGATTGCAAACAATCTCTATC-CCCAGATGAATTGGGCCTCACATC 59 HPeV8 GAGGATAAAGTCGAAGAATGCAAACAGACATTGTC-CCCAAATGAACTAGGCTTGACATC 59 HPeV3 GAGGACAACATGGAAAATTGTAAACAGTCCATATC-ACCAAATGAATTGGGTTTGACTTC 59 ** ** * ** ** ** * * * ** *** * ** * ** ** HPeV1 AGCCCAAGATGATGGCCCACTTGGTCAAGAAAAGCCAAATTATTTTCTCAATTTTAGGTC 119 HPeV6 AGCACAGGATGATGGACCTCTAGGTGGGGAAAAACCAAATTACTTTCTAAATTTTAGAAC 119 Consensus AGCCCAGGATGATGGACCATTGGGCGATANCAAGCCAAATTATTTCCTAAATTTCAAGTC 117 HPeV4 AGCCCAAGACGATGGTCCTCTGGGAGGTGAAAAGCCAAATTACTTCTTGAATTTTAGAGC 119 HPeV5 AGCACAAGATGATGGGCCCCTTGGAGTAGAGAAACCAAATTATTTTCTAAATTTTAGAGC 119 HPeV2 AGCACAAGATGATGGCCCTTTAGGAAATGACAAACCAAATTATTTTCTTAACTTTAAGTC 119 HPeV7 AGCCCAAGATGATGGACCTCTCGGGTCCGAGAAACCAAATTATTTCTTAAATTTTAGGGC 119 HPeV8 CGCTCAAGATGATGGGCCACTTGGCAATGAAAAACCTAATTACTTCCTCAACTTTAAAGC 119 HPeV3 AGCTCAAGATGATGGGCCTTTGGGTAATGAGAAACCAAATTATTTTTTAAACTTCAGAAC 119 ** ** ** ***** ** * ** ** ** ***** ** * ** ** * * HPeV1 GATGAATGTGGACATTTTTACTGTATCACATACTAAAGTAGATAACCTATTTGGGCGGGC 179 HPeV6 TATGAATGTGGACATTTTCACGGTATCTCATACAAAAGTGGACAATATATTTGGTCGCGC 179 Consensus TATGAATGTAGACATCTTCACTGTTTCCCACACTAAGGTGGACAACTTATTTGGAAGAGC 177 HPeV4 TGTCAATGTTGACATATTTACTGTGAGTCACACTAAAGTAGACAACATCTTTGGTAGGGC 179 HPeV5 AATTAATGTAGATATCTTTACTGTTAGTCATACTAAGGTAGATAACATTTTTGGGCGTGC 179 HPeV2 TATGAATGTTGATATCTTTACTGTCAGTCACACCAAAGTAGACAATATTTTTGGACGTGC 179 HPeV7 AATGGATGTTGATATTTTCACCGCAAGCCACACTAAAGTAGATAACATTTTTGGGCGTGC 179 HPeV8 AATAAATGTGGATATTTTCACAGTGAGCCATACAAAAGTGGATAATATTTTTGGAAGGGC 179 HPeV3 TATGAATGTTGACATTTTTACAGTAAGTCATACCAAAGTTGACAACATCTTTGGTAGAGC 179 * **** ** ** ** ** * ** ** ** ** ** ** * ***** * ** HPeV1 ATGGTTTTTTATGGAGCATACTTTCACCAATGAGGGACAATGGAGAGTGCCATTGGAATT 239 HPeV6 CTGGTTTGTGACAAGCCATGATTTTAACAATGAGGGACAATGGCCCTTAAATTTGACTTT 239 Consensus ATGGTTCTACCAGGAACACACTTTTACAGACGAAGGACAGTGGAGAGTTAATTTGGAGTT 237 HPeV4 ATGGTTTGCATATGATCATACATATAGAGATGAAGGAACCTGGAGGCAGGCTTTGGATTT 239 HPeV5 ATGGTTGGCCCTTGAACACACATTTGCAGATGATGGAACATGGAGGGCAGATTTGAATTT 239 HPeV2 TTGGTTTGCCCATGTTCATGACTTCACTAATGATGGCCTATGGAGACAGGGATTGGAATT 239 HPeV7 CTGGTACAACTCACGGCATGAATTCACAAATGGTGATCTGTGGCGTAGTTCATTGACTTT 239 HPeV8 ATGGTATTCTATGGCTCATGAATTTAGAAATGAAGGTTTGTGGAGGACTAAACTTACTTT 239 HPeV3 TTGGTATGTGACGTCTCATGACTTTAATAATGGAGATACCTGGAGGCAGAAATTAACATT 239 **** ** * * * * *** * ** HPeV1 TCCAAAACAAGGTCATGGGTCCTTATCACTGTTGTTTGCTTATTTTACTGGTGAACTGAA 299 HPeV6 TCCATTTGAAGGTCATGGCTCTTTATCATTATTGTTTGCATATTTCACTGGAGAACTAAA 299 Consensus CCCAAAACAAGGTCATGGTTCACTTTCTCTGCTATTTGCTTATTTCACAGGTGAATTAAA 297 HPeV4 CCCAAAGAAAGGCCATGGTGCCTTAACCCAATTATTTGCCTATTACTCAGGAGAATTAAA 299 HPeV5 TCCCACACAGGGTCATGGTACTCTGACAAGACTCTTCACATATTACTCTGGTGAATTAAA 299 HPeV2 TCCAAAGGAAGGGCACGGTGCCCTATCACTTCTGTTTGCCTACTTTACTGGTGAATTAAA 299 HPeV7 CCCTAAGAAAGGCCATGGGATGCTATCACAACTTTTTGCATATTTTACGGGTGAAGTGAA 299 HPeV8 CCCAAAACAAGGCCACGGTGCACTTTCACAATTTTTTGCTTATTATACTGGAGAGTTAAA 299 HPeV3 TCCAAAAGAGGGTCATGGTATGTTATCACAGTTTTTTGCTTATTTTACAGGAGAAATAAA 299 ** * ** ** ** * * * ** * ** * * ** ** * ** HPeV1 TATCCATGTTCTGTTCCTAAGTGAGAGGGGGTTTCTGAGGGTTGCACACACATATGACAC 359 HPeV6 TATACATGTTCTATTCTTGTCAGGCAAAGGCTTTTTGAGGGTTGTACACACTTATGACAC 359 Consensus CATCCATGTTTTGTTCTTAGCTGGAAAAGGATTTCTTAGAGTAGCTCATACATATGACAC 357 HPeV4 TATACATGTTTTATTCTTGAGTGAAACAGGGTTTCTGAGAGTGGCACATACTTATGACAG 359 HPeV5 TGTGCATGTACTGTATCTTAGTGACAATGGGTTCCTCCGAGTAACTCATGCCTATGACCA 359 HPeV2 CATCCATGTTCTATTTCTTAGTGATAGGGGTTTTCTCAGAGTTGGACATACATATGACAC 359 HPeV7 TATACATATCCTTTATATGGCTGAAAGAGGATTTCTTAGAGTGGCACACTCATATGACAC 359 HPeV8 TATCCATGTACTGTTTTTGTGTGAAAAAGGTTTTCTCAGAGTAGCTCACACATATGACAG 359 HPeV3 TATTCATATCCTATATATGGCAAAGCAGGGGTTCCTTAGAGTGGCTCATACATATGACAC 359 * *** * * * * ** ** * * ** ** * ****** HPeV1 TAGTAATGATCGAGTCAATTTTCTGTCATCGAACGGTGTAATAACTGTACCAGCCGGAGA 419 HPeV6 TGCTGATAATAGATTAACTAACTTGGCCTCTAATGGCGTGATCACCATACCAGCTGGAGA 419 Consensus ATCAGAAAATAGAGTTAACTTCTTGTCATCTAATGGTGTTATCACAATCCCAGCGGGAGA 417 HPeV4 TGATACAAACAGGTCTGACTTCTTCTCTTCAAACGGCGTCATCACTGTGCCCGCAGGGGA 419 HPeV5 TGATAATGACAGATCCAACTTTTTGTCATCCAATGGAGTAATTACAGTGCCAGCAGGTGA 419 HPeV2 TGAGACAAACAGAACCAATTTTTTATCATCCAGTGGCATAATTACAGTACCAGCAGGAGA 419 HPeV7 TGAGACACAGAGGGATGACTTTCTATCATCAAATGGTGTGATAACAATACCAGCTGGAGA 419 HPeV8 TGATGAGGGGCGAGATGACTTCTTGTCATCCAATGGAGTCATTACCATACCAGCTGGAGA 419 HPeV3 TGAAGATAATAGGAAAACTTTCTTGTCTTCAAATGGGGTAATAACTATCCCTGCTGGTGA 419 * * * ** * ** * ** ** * ** ** ** ** HPeV1 GCAGATGACACTTTCAGCTCCCTACTATTCAAACAAACCATTAAGAACTGTCAGAGATAA 479 HPeV6 ACAAATGTCATTATCAGCCCCTTTCTATTCTCACAAGCCATTGAGGACGGTTAGGGACAC 479 Consensus ACAAATGACATTATCTGCACCTTACTACTCAAATAAACCCCTTAGGACAGTTAGGGACAG 477 HPeV4 ACAAATGACCCTGTCAGTACCATTCTACTCTTCAAAGCCCTTGAGGACAATCAGGGATTC 479 HPeV5 ACAGATGACGCTTTCTGTGCCATTCTATTCTTCTAAACCACTTAGAACAATAAGAGAAAC 479 HPeV2 ACAGATGACACTATCTGTCCCCTCTTATTCCAACAAGCCATTACGGACAGTTAGATCATC 479 HPeV7 ACAAATGACTTTATCTGTACCATACTACTCAAATAAACCATTGAGGACTATAAGACATGA 479 HPeV8 GCAAATGTCTCTATCTGCTCCATTCTACTCACACAGGCCATTGAGAACAATTCGCAATGA 479 HPeV3 GCAGATGACACTCTCAGTACCTTTTTATTCAAACAAGCCTCTGAGGACAGTGCGCCATGA 479 ** *** * * ** * ** * ** ** * ** * * ** * * HPeV1 CAATAGTCTTGGTTATTTGATGTGCAAGCCCTTCTTGACTGGAACCTCTACTGGTAAAAT 539 HPeV6 TCACAGCTTGGGTAGGCTTATTTGCAAACCATTCCTGACTGGAACAACATCTGGCAGGAT 539 Consensus CAATAGTCTTGGGTATCTGATGTGCAAGCCATTCCTCACTGGAACAACAACAGGGAAAAT 537 HPeV4 AGCTGCTCTAGGGTATGTGATGTGTAAACCATTCATGTCTGGGACAACAGGTGGAAAGAT 539 HPeV5 TGGTGCATTAGGCAAATTAATCTGTAAACCATTGTTGTCTGGCACACATTCAGGGAAGAT 539 HPeV2 CAATGCTTTAGGTTATTTACTGTGTAAACCATTGCTAACTGGTACCAGCTCTGGTAGAAT 539 HPeV7 ATCAGCACTTGGTTTCTTGTTGTGTCAACCACTTTTATCAGGTACAGACAGGACTATTGC 539 HPeV8 GGATGCATTAGGATATTTACTATGTCAACCTATGCTTACAGGAACATCAAGTGGCAAGAT 539 HPeV3 TTCAGCATTAGGTTTTCTTATGTGTAGACCATCGATGCACGGGACTACACGAACTACTGT 539 * ** * * ** ** * ** ** * HPeV1 TGAGGTTTATCTTAGCCTGAGATGTCCAAATTTCTTTTTCCCTCTTCCTGCCCCTAAGGT 599 HPeV6 AGAAGTATATATGAGTCTCAGGTGCCCAAATTTCTTCTTTCCTGTTCCAGCACCAAAAAA 599 Consensus AGAGGTCTACCTTAGCCTGAGGTGTCCAAATTTCTTCTTTCCTCTCCCCGCGCCTAAAGT 597 HPeV4 AGAGATATATCTGAGTTTAAGATGTCCAAACCTATTCTTTCCCTTACCAGCTCCGAAACC 599 HPeV5 CGAAGTTTATTTGAGTCTCAGATGCCCTAATCTATTCTTTCCTTCTCCTGCACCTAAAGA 599 HPeV2 AGAGATATTCCTTAGCTTGAGATGTCCAAATTTCTTCTTTCCCTTACCAGCACCAAAACC 599 HPeV7 AGAAGTATATATTAGCTTAAGGTGTCCAAACTTTTTCTTTCCAGCGCCAGCACCTAGACC 599 HPeV8 TGAGGTGTATCTCAGCTTGAGGTGTCCAAATCTGTTTTTTCCAATCCCAGCACCTAAGCC 599 HPeV3 AGAAGTTTATGTTAGTTTAAGGTGCCCCAATTTCTTTTTCCCTGTACCAGCTCCTAAACC 599 ** * * * ** * ** ** ** ** * ** ** ** ** ** ** * HPeV1 TAC -G -AGTAGTCGTGCACTACGGGGTGATATGGCAAACCTTACAAATCA 647 HPeV6 CACACCACGCTCG -CAAAGTCGTGCTCTACGAGGTGATATGGCTAATTTGACAAATCA 656 Consensus AAC -A -ACTGGTCGTACTTTGCGGGGTGACTTGGCAAATTTCTCAAACCA 645 HPeV4 TGC -A -ACTAGTCGTGCTTTGCGGGGTGACATGGCAAACTTCTCAGACCA 647 HPeV5 GAA -A -ACTTCCAGAGCTTTGCGGGGTGACTTGGCAAATTTTATAGATCA 647 HPeV2 AGC -AACACGTAAATATAGAGGAGATTTGGCAACATGGTCTGACCA 644 HPeV7 AATTAATACTACA -CCAATAGGC -TACAGTAACGAAAGCCCATATGGTCAAGAACA 653 HPeV8 TGCCAATGCATTAAGGTCACTCAACCCATTTAGTGATGAAAGTCCATATG -AAGCACC 656 HPeV3 AACTGGTTCAAGG GCTACAGCAC TTTCTGATGAG 633 ** HPeV1 G 648 HPeV6 G 657 Consensus HPeV4 G 648 HPeV5 G 648 HPeV2 A 645 HPeV7 AGTGACAAC 662 HPeV8 AAT 659 HPeV3 Discussion: I have started the experiment with an premise of HPeV virus infected the kid demoing mild diarrhea. The isolation of viral genome from the clinical sample utilizing Qiagen kit ( rule: selective binding belongingss of silicon oxide gel ) and Agarose gel cataphoresis proved that the viral genome was RNA. From analyzing the Agarose gel photographic image it clearly showed that the RNA isolation was successful ( Fig: 2 ) . From the gel photographic image of RT-PCR ( Fig:3 ) , we can presume that the PCR merchandise DNA is holding a molecular weight closer to that of 1018bp in the marker DNA. By plotting the graph between the molecular weight of DNA marker with the distance migrated in the gel ( Fig:4 ) , I could turn out the approximate molecular weight of DNA sample after PCR which is closer to the false value got from gel cataphoresis. The sequences which are complimentary to the primers used were selected as primer binding sites inorder to magnify under specific thermic rhythms. The absence of set in the negative control shows the RT- PCR done was right without any taint. The RT-PCR has helped to uncover speedy DNA elaboration which is advantageous over traditional PCR. It besides collects informations in the exponential growing stage whereas traditional PCR is measured at the terminal point. The cloning of PCR merchandise done utilizing pGEM R -T easy vectors which contain T7 and SP6 RNA polymerase boosters. A group of scientist under Smeekens.S.P has done their survey on T7 booster sequence. T7 RNA polymerase which has specific adhering belongingss with T7 boosters determines the reproduction of bacteriophage. The booster specific binding was shown to be insensitive to fluctuation in the ionic strength of incubation solution but found sensitive to DNA spiral. The efficiency of polymerase-promoter unfastened composites are determination factors of written text. ( Smeekens.S.P et.al ( 1986 ) Promoter and nonspecific DNA binding by T7 RNA polymerase, Oxford diary on Nucleic acids Research,14,2811-2827 ) The chief intent of utilizing the pGEM R -T easy vector is that, it is holding multiple cloning parts. It has ampicillin opposition cistron which would do the host cell to last in Principen rich medium. There are EcoR1 limitation enzyme acknowledgment sites on both sides of ligated RT-PCR merchandise in the vector. Thus the plasmid isolation after the Transformation is done utilizing EcoR1 enzymes. The enzyme DNA ligase ligated the RT-PCR merchandise into vector. The Deoxyribonucleic acid with the vector is transformed into competent E.coli cells. The inability of E.coli to accept DNA leads to do it competent utilizing CaCl2. If the whole procedure was successful we would hold got bluish and white settlements of cloned cells in the LB stock home bases. But the bluish settlements were non able to separate decently in the thick of other ampicillin sensitive settlements. The ground for the complete growing of unwanted settlements might be due to the low concentration of Ampicillin added as experimental mistake. Thus the Principen sensitive cells besides multiplied along with cells incorporating vector and cistron of involvement. As a consequence there was no set produced in the Agarose gel cataphoresis from the bluish settlement cells. The plasmid DNA isolated from the cloned cell was used for sequencing on both orientations without the separation of fragment. The Deoxyribonucleic acid sequence is analysed utilizing the package plan. The finding of direct or indirect orientation of DNA sequence is done utilizing Blast nucleotide hunts. The T7 belonged to human parechovirus1 ( length7380 ) was direct orientation with +/+ strand while SP6 belonged to human parechovirus1 ( length 7380 ) was found to be indirect with +/- strands. The contrary compliment for SP6 was taken and the alliance done utilizing Clustalw. Then with different HPeV type sequences the consensus sequences are compared utilizing Clustalw. By analyzing the sequences and phyletic tree the sequence isolated from clinical sample has similar hereditary beginning with HPeV1 type Parechovirus. Hence it is identified that the kid is infected with Parechovirus type1 infection. Recognition: I would wish to widen my sincere gratitude to Professor Glen Stanway, University of Essex, for his support and counsel for my practical work. I am besides widening my thanks to Ms. Maysoon, PhD pupil for her support during the practical work.
Wednesday, February 26, 2020
Case Study Example | Topics and Well Written Essays - 500 words - 20
Case Study Example Created in the contract were a series of award fees eligible to Textron at the end of each of the performance period based on its performance during that period. However, the decision as to the amount that Textron would receive and if so how much was left to the discretion of the Fee Determining Official ("FDO") based on the FDOs assessment of Textrons performance in several specified areas. It was a struggle funding the project, since from summer of 1985 up to the end of 1987 Textrons expenditures under the contract exceeded the allocated funding. Even before the award of the contract, the contracting officer made it clear to Textron that there was a possibility of the SDI[O] stopping the funding of EMRLD. The problem became worse in 1987 when both SDIO and Air Force stopped funding the project. After completing its close up work, Textron on December 19, 1990 submitted a termination settlement proposal to the government requesting $13,428,348 over and above the $113,479,301 paid to date under the contract. The CPAF contract called for a zero base fee and an as award fee not subject to the Termination or disputes clauses as to the payment and amount of the award fee. During the course of the contract, the contracting officer repeatedly reminded Textron that the LOF clause in the contract remained in effect. The language of the contract did not allow Textron to receive any extra amount after the termination b of the contract. According to the courtââ¬â¢s rationale, Textron failed to prove beyond any reasonable doubt that it was in deed eligible for the extra payment. According to the language of the contract, the court ruled in favor of the government. Since Textron was aware of the likelihood of the government stopping the funding of the project, and as expressed in the contract that there would be no award of the termination fee, then the court ruled in
Monday, February 10, 2020
MGT302 - Org. Behavior and Teamwork CA Essay Example | Topics and Well Written Essays - 750 words - 1
MGT302 - Org. Behavior and Teamwork CA - Essay Example Unfortunately, it takes a certain mix of educated thought processes and considerations to be able to make the best decision that would apply to a given situation. The article entitled, ââ¬Å"Herbââ¬â¢s Concoction (and Marthaââ¬â¢s Dilemma): The Case of the Deadly Fertilizer,â⬠Customer Affairs Department personnel Martha Wang needs to decide on how to handle information from a customer complaint claiming that the best-selling product of their company, Herbââ¬â¢s Garden, allegedly caused the death of the customerââ¬â¢s animal. Thus, Martha needs to make what is called a non-programmed decision. Non-programmed decisions are so unique and important that they require conscious thinking, information gathering, and careful consideration of alternatives. This is in contrast with programmed decisions which occur frequently enough that one already develops an automated response to them. . Martha faces quite a dilemma in this case. First, she herself has had a previous experience that is similar to the issue being raised by the customer. However, when she addressed this issue to upper management, it was simply dismissed as being a case of an overreacting customer. Furthermore, the companyââ¬â¢s owner personally requested Martha to take care of the situation. in such a crucial situation, individuals may be overwhelmed by the pressure that they face. Therefore, Martha must carefully analyze the situation and weigh all alternatives to come up with the best option. Furthermore, in turning decision making into a more manageable affair, Bauer and Erdogan (2005) suggest that one asks the following questions: For Martha, the necessary first step would be to do some background research. She could try to look into the companyââ¬â¢s history in terms of customer feedback, especially concerning the particular product which is Herbââ¬â¢s Special Fertilizer Mix. If she feels that there is indeed sufficient customer complaints similar to the one brought up by the client that
Thursday, January 30, 2020
Health and Social Care Essay Example for Free
Health and Social Care Essay Our campaign was a drugs campaign our main aim was to inform people on drugs and what effects it can have and to not stereotype drug users as they can be anyone. M2- Positive influences I felt our group were very well prepared as we had a good use of resources. This included plenty of leaflets to give out on drugs to inform people on the effectiveness on drugs. We also had a laptop with the Talk to Frank game on it available for people to play, and other drugs game activities that were available for people to take part in. We also gave out questionnaires and cakes which rewarded those for taking part. We also had plenty of space to set up the table and all the activities. This was important as not having enough space would have meant not being able to set up all the activities we made. We also, had plenty of time as we had a good time slot of 2 hours between 11 ââ¬â 1 to implement the campaign. This gave more time for us to hand out questionnaires and inform and teach more people on the effects of drugs. We all took part equally in the campaign as we were involved in the stereotyping activity where we all attached signs to us asking ââ¬Å"do you think I take drugs? where we asked people with regarding what we looked to like to whether we took drugs or not. Read more: Identify ways of working that can help improve partnership workingà essay This involved us dressing up in particular clothes which seemed to be very effective rather than showing pictures of people. I believe we also taught lots to people as many people were shocked at the information gave to them especially about the ââ¬Å"legal highs activityâ⬠. Negative influences I felt we didnââ¬â¢t all equally participate in preparation as the questionnaire and research I made were not used and a different questionnaire was made. This in effect made it seem as if my contribution was not necessary. I also, felt that I didnââ¬â¢t take part in setting up the campaign as the presentation tasks went to other group members. However, the campaign involved dressing up as characters and I believe that we all did a good job of dressing up except certain members of the group didnââ¬â¢t dress up as they should of as originally, we had the plan of someone dressing up in a suit to show that your appearance doesnââ¬â¢t affect whether taking drugs or not. This was important as not only were we raising awareness we were teaching about tereotypes. Also, the people that came to the campaign didnââ¬â¢t engage in all activities as we hoped as there was so many to take part in and so much information to give out. Also, our target audience were teenagers as there was evidence most drug users were around this age However, mostly adults came. I felt we had a limited audience and not as many people as we thought came to the campaign and a lot of the people had learning disabilities in which we werenââ¬â¢t prepared for and didnââ¬â¢t cater for. M3 ââ¬â Ethical issues One of the main ethical issues in our campaign was confidentiality.à Confidentiality is important as during the campaign someone may come forwards and confide in you about drugs or there drug intake and it is important that confidentiality is not breached and that personââ¬â¢s name is not discussed and their privacy is kept. As we gave out questionnaires, they were kept anonymous so therefore, all information received from the campaign can be kept confidential as one of the questions was ââ¬Å"Do you know anyone that takes drugsâ⬠which although this was a closed question it was quite personal and anyone answering might of felt uncomfortable if the questionnaire was to ask your name. This then links to safe guarding. During the campaign no one came forward with any information that could of lead them to be unsafe However, it was important that information we gave out was correct and that we werenââ¬â¢t giving false information which could lead someone to danger when taking drugs. This I felt we did successfully as all research given out was from drug websites such as Talk to Frank. Also, other ethical issues include choice and own beliefs. I believe that when giving out information we didnââ¬â¢t preach any of our own beliefs to anyone. It was completely factual. As this could of lead someone to feel uncomfortable as everybody has the right to choose whether they take drugs or not and if it is important that when teaching that you are not preaching your beliefs about people taking drugs as this could lead to offending someone who is taking them. Finally, it is important to not ask any inappropriate questions as this could lead to someone feeling uncomfortable. All personal questions that needed to be asked during our campaign were on an anonymous questionnaire which didnââ¬â¢t involve any questioning from anybody from our group. Therefore, making people feel comfortable in answering. Other questions asked by us were ââ¬Å"do you think I look like the type of person that takes drugs? â⬠as we were dressed up as characters. However, this question was asked after we explained that we were dressed up as characters as part of the campaign so people felt comfortable in answering without offending. Also, the question ââ¬Å"would you like a cake? â⬠for those who didnââ¬â¢t want to take part in any of the activities. D2 ââ¬â During our campaign we gave out questionnaires after people took part in the activities. However, only 32 people answered the questionnaire. According to the questionnaire 22 people out of 32 knew someone who takes drugs that left only ten people who didnââ¬â¢t know anyone who took drugs. According to the Shropshire star ââ¬Å"16 local Shrewsbury men had a powerful and overbearingââ¬â¢ influence on others in the drugs chain and was said to be taking ? 15,000 a month from the trade. â⬠ââ¬Å"Phoenix Car centre was aware of the extent of drugs operation and played significant part in getting drugs to the street of Shrewsbury under orders from other people. Some of these men are parents to teenagers in Shrewsbury and therefore, it is possible that some of the people that filled out the questionnaire knew these men. http://www. shropshirestar. com/news/2013/03/03/how-police-smashed-shropshire-drugs-cartel/ Also, 28 out of 32 people were made more aware of the effects of drugs after the campaign whereas only 4 people didnââ¬â¢t. This could of meant that they already knew about the effects drugs had on someone or they didnââ¬â¢t feel out campaign gave much information on the effects drugs have one someone. However, more than three quarters did find out more about the effects of drugs which is positive. This could suggest that existing campaigns arenââ¬â¢t using the correct technique as we did to inform people on the effects of drugs. Talk to Frank is a website that only offers online information and a call centre in which people are able to access to talk about drugs. However, although our campaign used most of the Talk to Frank information we implemented it in a different way which was more effective to informing people on the effects of drugs. ââ¬Å"Since 2011 the Talk to Frank website has had a 6% increase in feedbackâ⬠Therefore, It could suggest that people are using the website a lot more than previously. This could be why some people didnââ¬â¢t learn anymore about the effects of drugs and as our campaign was implemented directly through explaining we were able to teach more people about the effects. http://www. clear-uk. org/talk-to-frank-is-back/ 29 out of 32 people found out more information about drugs after the campaign was implemented. This meant that only 3 people didnââ¬â¢t learn anything from the campaign. This could have meant that they already knew or that our campaign wasnââ¬â¢t very informative. However 29 people did find it informative, which is more than 3 quarters of the people that were involved. Therefore, I feel as though our campaign did inform people well. Also, when questioned how useful the campaign was statistics show that 19 people thought our campaign was really good 11 people thought it was good and only 2 people thought it was average. And nobody felt our campaign was poor or really poor. Therefore, more than half thought out campaign was really good and useful and the rest thought it was good or average. This is positive results. Overall, our campaign results are very positive. This means that our campaign was very beneficial. I feel that our campaign went really well due to the positive feedback that we got of the audience. This is proved with results from our questionnaire which we gave to the audience to get their personal opinions on how well our campaign was to them. When giving out the questionnaire I felt we were present and observant when the questionnaire was filled out. Therefore, I feel that the results we got back from the questionnaire may be slightly warped due to people not wanting to be judged or questioned about their answers if they were negative as although it was anonymous it was very overt. Other campaigns use the questionnaire online and get feedback from the public, such as the Talk to Frank website and if I were to do the campaign again I would allow people to step aside to fill in their questionnaire and ask them to put it into a box I feel this covert way of gathering information is much better as it gives the public privacy which makes them able to write down their real thoughts and opinions about the campaign and not put answers to be polite. However, I felt our campaign nformation was as good as Talk to Frank as we had the talk to Frank games available and we were able to use a good range of information from the Talk to Frank website to bring awareness about the effects of drugs. http://www. talktofrank. com/? gclid=CLf-1dOy6bcCFQ3KtAod_Q4AnA A National campaign launched by the Australian government in 2011-2012 also used public speaking and posters to communicate to the public about the awareness of drugs and it was also very effective for them. They also collected results from their campaign on how it affected certain people and how it has made a difference for these certain people, how theyââ¬â¢ve become more aware of drugs and the dangers, how they now feel about drugs and if they would ever attempt to take drugs. Which is slightly different from our campaign questionnaire but it is still the same method of gathering information and still very similar to the way in which we implemented our campaign. http://www. drugs. health. gov. au/internet/drugs/publishing. sf/content/campaign4 This proved very good in some aspects as there has been an increase in showing that drugs are harmful and helping people avoid using drugs which is very similar to our campaign in the fact it is bringing awareness by showing that drugs are bad and harmful by looking and there effects. Also, other statistics show that more adults are talking more to their children about substances after the campaign which again is bringing awareness and also p romote two way communications.
Wednesday, January 22, 2020
Phaedo Summary Essay -- essays research papers
Phaedo Summary à à à à à Socrates stands now before his disciples telling them he is not afraid of dying because he says death is what the true philosopher waits for all his life. The philosopher must have lived a good life, and when death is presented upon him, he should take the opportunity. Socrates formed a conclusion that: ââ¬Å"That the real philosopher has reason to be of good cheer when he is about to die, and after death he may hope to obtain the greatest good of the world.â⬠Socrates is saying that when death is presented upon him, he should have no reason but to be happy, and when that death comes; he will have achieved the best gift in the world. à à à à à Socrates states evidence of why he is not afraid of dying through multiple mini-conclusions. Socrates says to Simmias, ââ¬Å"Why when his time comes should he repine at which he has always been pursuing and desiring?â⬠Socrates is saying why should philosophers grieve at death when that should be the goal of their whole lives. He believes only philosophers can understand because he believes philosophers will be truly alive after death, and normal men will just die. Normal men do not know that true philosophers have always been pursuing death and dying, and the desire of death has been with them all their lives.à à à à à à à à à à Through out his whole testimony, Socrates states questions to his disciples already knowing the answers, but he...
Tuesday, January 14, 2020
Foreign Policy 1776-1807 Dbq
During the Washington, Adams, and the Jefferson administrations, the United States was thrust into the decision of joining either Britain or France, the two most powerful European nations. In determining the effects of foreign policy on the developing nation, one must establish the overall direction of the United States took. As a budding nation, George Washington proposed the idea of neutrality in order for the country to have no involvement in European affairs. However, Federalists and Democratic Republicans were outraged by this decision since the Federalists supported the British while the Democratic Republicans supported the French. Neutrality also allowed the United States to temporarily smooth its relations with Europe because of commercial interest. Therefore, neutrality, instead of siding with either Britain or France or through their commercial interests, was the obvious direction taken by foreign policy. After witnessing and being involved in uncontrollable European affairs, the growing nation of the United States concluded that an international policy of neutrality would be the best option in the area of foreign affairs. During his presidency, Washington decided that it was best for America to stay neutral. As stated in his Proclamation of Neutrality that any American providing assistance to any country at war would be punished with legal proceedings (D). He was aware of the possible dangers that would occur when allying with a certain country. The country was too new to enter any wars or deal with wars of foreign countries. ââ¬Å"Europe has a set of primary interestsâ⬠¦Hence she must be engaged in frequent controversies, the causes of which are essentially foreign to our concernsâ⬠(J). Even in his farewell address, Washington advised the fledgling nation to not get involved in European affairs or make permanent alliances, to avoid sectionalism, and to not form political parties. After Washington resigned from office, John Adams tried to maintain the position of neutrality as the second president of the United States. He did as much as he could in avoiding war with France. Even before his presidency, in response to a proposed alliance with France, he argued that ââ¬Å"â⬠¦we ought not to enter into any Alliance with her [France], which should entangle Us in any future wars in Europe, that We ought to lay it down as a first principle and a Maxim never to be forgotten, to maintain an entire Neutrality in all future European Warsâ⬠(A). However, after the XYZ Affair, in which French agents demanded a large bribe for the restoration of diplomatic relations with the United States, a Quasi War erupted between France and America. The Convention of 1800, also known as the Treaty of Mortefontaine, was a treaty between the United States and France to settle the hostilities that erupted during that war (I). When Thomas Jefferson became president, it was a peaceful transition from Federalist to Democratic Republican. Despite the differences between these political parties, Jefferson also tried to maintain Washingtonââ¬â¢s idea of neutrality. In his Inaugural Address in 1801, he states ââ¬Å"We are all Republicans, we are all Federalistsâ⬠and that there would be ââ¬Å"Equal and exact justice to all men, friendship with all nations, entangling alliances with noneâ⬠¦Ã¢â¬ (K). Even as a last resort to the Louisiana Purchase, he told Monroe to make an alliance with Great Britain if the Louisiana Purchase did not work out. In all three of their presidencies, Washington, Adams, and Jefferson decided that it was best for the new nation to enter a state of neutrality. Despite its neutrality and unwillingness to enter war with the European nations, the United States were being forced to side with either Great Britain or France, Europeââ¬â¢s most powerful nations. During Washingtonââ¬â¢s presidency, the revolutionary government of France sent diplomat Edmond-Charles Genet, also known as Citizen Genet, to America to propagandize the case for France in the French war against Great Britain, which created the network of Democratic Republicans. Washington demanded the French government recall Genet, and denounced the societies. The United States were in a conflict with Britain, as the British were seizing American ships and impressing sailors. Hamilton and Washington designed the Jayââ¬â¢s Treaty to normalize trade relations with Britain, remove them from western forts, and resolve financial debts left over from the Revolution (F). John Jay negotiated and signed the treaty in 1794. However, many disputes rose from this decision. James Madison criticized that the treaty stated to open West India ports to the United States, yet Britain refused to follow these regulations (G). During Adamââ¬â¢s presidency, the XYZ Affair, which was supposed to have been the negotiation between America and France on the seizure of American ships, threw the United States into a Quasi War with the French. In the aftermath of the undeclared naval war with France, the Alien and Sedition Acts were passed, which allowed the president to deport hostile aliens, increased residency requirements for citizenship, and banned criticism of government policies or officials. After the United Statesââ¬â¢ conflict with France, Jefferson, a Democratic Republican, considered the possibility of an alliance with Britain. While Britain and France were both seizing American ships, Britain had the strongest navy and was thus able to force the American sailors into its navy (M). Jefferson believed that this conflict would cease if the United States agreed to establish an alliance with Britain. Torn between the conflict of siding with either France or Britain, the United States agreed to remain neutral. Although neutrality in the new nation was favored, there was a possibility of joining either Britain or France depending on which one was more financially beneficial. After Jayââ¬â¢s Treaty, which was signed with Great Britain during Washingtonââ¬â¢s presidency, Spain did not want the United States to side with the British and wanted to smooth its relations with the fledgling country. Pinckneyââ¬â¢s Treaty, signed on October 27, 1795, established the intentions of friendship between the United States and Spain. The treaty also granted the States use of the Mississippi and right of deposit at New Orleans (H). In the Treaty of Paris in 1783, ââ¬Å"It is agreed that the people of the United States shall continue to enjoy unmolested the right to take fish of every kind on the Grand Bankâ⬠¦Ã¢â¬ and that ââ¬Å"The navigation of the river Mississippi, from its source to the ocean, shall forever remain free and open to the subjects of Great Britain and the citizens of the United Statesâ⬠(E). Thomas Paine stated that commerce would secure the friendship with Europe because Europe wants America to have a free port (B). Jefferson, fearing the power of the neighboring French in the Louisiana Territory, sent Monroe to Paris to negotiate the purchase in 1802. Their interest was only in the port and its environs. They did not anticipate the much larger transfer of territory that would follow. The purchase greatly benefited the United States because it granted them access to the entire Mississippi River. Also, as a result of impressments of American sailors, Jefferson established the Embargo Act of 1807, also known as the Nonintercourse Acts, restricting American ships from engaging in foreign trade between the years 1807 to 1812. Jefferson believed that without trade with the United States, Britain and France would fall into an economic crisis. However, the Europeans nations did not bother with America and traded with other countries, causing the new nationââ¬â¢s economy to fall. This outraged the general public, and when Jefferson left office, these acts were repealed. Commercial interest helped the United States to choose between siding with either of the European nations or remaining neutral. Throughout the Washington, Adams, and Jefferson administrations, Britain and France tried to force the United States into allying with either of the two nations. Although it was tough to maintain, neutrality was established in the country by Washington. The decision brought various problems for the budding nation, but it still stayed strong.
Monday, January 6, 2020
Subscribe to:
Posts (Atom)