Acupuncture as a nonconventional treatment for chronic neck pain Essays

Needle therapy as a nonconventional treatment for ceaseless neck torment Essays Needle therapy as a nonconventional treatment for ceaseless neck torment Essay Needle therapy as a nonconventional treatment for ceaseless neck torment Essay Paper Topic: Whiplash Needle therapy as a nonconventional mediation for ceaseless cervix harming Presentation IntroductionNeck harming has been named one of the commonest occupations among the individuals. This status emerges from grouped surprises or it might emerge from tissues situated at the cervix ( Hush. et Al. . ( 2009 ) . The cervix is other than known as a cervical spinal section. The cervixs development is described by vertebrae which run from the upper trunk to the skull’s base. The stableness of the spinal section is related to tendons and musculuss that run along the vertebrae ( National Institutes of Health. ( 2013 ) . A neck’s boss significance is its portability and the help it accords to the caput. It is inclined to harms since it is non offered a lot of assurance like the rest of the spinal section. Wounds generally cause less and confined portability and triggers NAIP. Lamentably neck harming are non agreed genuineness. the vast majority treat the cervix harming as ephemeral. There are separated from everyone else occasions where the side effects do non trave l off and along these lines diagnosing and comparing mediation is required ( American Academy of Orthopedic Surgeons ( 2013 ) . Scientists ( De Loose. V. . Burnotte. F. . Cagnie. B. . Stevens. V. . A ; Van Tiggelen. D. ( 2008 ) . have discovered that the strivings are brought about by a few factors, for example, mileage. injuries and abnormalcies of the cervix tissue. There is grounds of cervix strivings beginning from different strivings, for example, arm or shoulder strivings ( De free. 2008 ) . Typically exercises, for example, most extreme decompression sicknesss of the cervix. falls and vehicle mishaps can do cervix harms. In certain condition of affairss mischief of the cervix can harm the spinal segment doing paralysis. Examination laborers have other than discovered that Spondylosis which happens in individuals over the age of 40. adds strains to make out enunciations clearing a path for constant cervix harming. Be that as it may, the status is treatable through both customary and nonconventional strategies. Exploration laborers and doctors have recognized stylostixis as a nonconventional mediation technique which is an extremely viable strategy for taking care of interminable cervix strivings. Scientist ( Blosssfeldt. 2004 ) . says that. stylostixis is determining drive as a mainstream nonconventional intercession technique for incessant cervix harming. He other than includes that. the technique has been acceptable endured and has low danger of unpropitious impacts. ( Liang et al. 2008 ) says that. a mix of both conventional and current stylostixis method typically bring about a reported and improved cervix harming structures. ( Blossfeldt. 2004 ) includes that stylostixis is generally acknowledged and it is used as a reciprocal treatment utile in cervix harming course emerging from cervical spondylitis. Examination laborers have done surveies partner to needle therapy precise reappraisal with a reason to occur out on stylostixis effectivity. The surveies have discovered viability grounds as uncertain ( salter et Al. 2004 ) . There are surveies which have created outcomes which are emphatically preferring stylostixis and there are different results which have delivered negative discoveries on the viable of the technique ( salter et Al. 2004 ) . Because of the differing outcomes. this exploration was created to occur out on the effectivity of stylostixis strategy as a non-ordinary technique in intercession of ceaseless cervix strivings according to other examination discoveries. With respect to national wellbeing insights and studies. Overview information examination can be utilized by clinical experts to mensurate the stinging degrees of patients when stylostixis intercession. Social event outcomes from grouped surveies and contrasting and the developments of stylostixis and safeguard steps of cervix strivings can help us find on the effectivity of stylostixis as a mediation technique. In this writing rethink the exploration laborer will reevaluate on 1 ) how to set up the practicality of stylostixis treatments in the mediation of constant cervix harming ; 2 ) trepidation of how accepted. sandbar and randomized stylostixis treatments are used in the intercession of constant cervix harming ; 3 ) flexibly a convincing grounds of the achievement of stylostixis as a perfect technique for mitigating harming ; 4 ) set up the impacts of the three stylostixis treatments in the mediation of people with ceaseless harming of the cervix ; 5 ) offer proposal of the suitability of stylostixis as a mediation alternative that can be utilized by individuals with interminable cervix strivings. The exploration laborer will other than contrast the duration of stylostixis intercession and different techniques furthermore the expense related and danger factors thereof. METHODOLOGYTarget PopulationThe research informations gathered in this study concentrated on patients suffering from ceaseless cervix harming. The people utilized in the examination fell inside the age of 21 and 55 mature ages old. Despite the fact that there are numerous patients who report about cervix harming protests in various health consideration establishments over the United States. patients withinthe ages of 21 and 55 mature ages old were perfect for this examination study. This was because of the way that they were simpler to follow their progression of retouching over a more extended time of clasp. Matured patients beyond 55 years old mature ages were non best positioned in this exploration sing the varying properties in the mending methods of such individuals. which was demonstrated to be relatively lower. The vast majority of the data aboutindividuals with incessant harming of the cervix was unpredictably gathered in wellbeing consideration establishments in the State of California. US. The greater part of these patients were determined to have constant cervix harming and were put under a specific point of convergence while three stylostixis techniques for treatments were performed ( Witt 2004. p. 99 ) . The review all around included a careful test of 191 patients in California’s wellbeing consideration. It is of import to concede that the various patients were purposefully started to needle therapy intercession as their assurance to look for the other clinical example after fruitless mediations in the standard clinical processs. There were without a doubt no limitation on the sex of the patients ; henceforth the examination included both male and female patients. Also. there was no predetermined figure of male or females in the overview. as patients. intercession and headway of mediation of patients was aimlessly taken. Further. it was expected that both male and female patients introduced comparative reactions to the distinctive stylostixis treatments acted in the overview ( Sun et al. 2009. p. 850 ) . The examination was non constrained by either ethnicity or race. in spite of the fact that accepted to hold various highlights in regard to grouped clinical processs. Factors of the studyThe dependant factors in this study incorporated the cervix harming as a grievance brought about by grouped aspects, for example, physical hurt and sickness or status among others. The paces of occurrences influencing constant cervix strivings during the time of this overview were overall exceptional as the reasons for such grumblings enormously shifted. Ceaseless cervix harming among the patients fluctuated in regard to the particular causes. which in this occasion included degenerative phonograph record sickness. neck hurt. cervix strain. herniated phonograph record each piece great as squeezed cervix ( Sun et al. 2009. p. 850 ) . The primary measure in the intercession procedure included a careful diagnosing of regular cervix diseases that caused the incessant harming. The exploration abuses intercession of such cervix strivings using stylostixis which falls into three classs including enhanced stylostixis. shallow stylostixis and expected stylostixis. Examination LimitationsThe cardinal limitations depended on cervix harming because of regular disease like infection contamination of the cervix and lymph no expanding. each piece great as different diseases, for example, TB of the cervix. meningitis. what's more, contamination of spine castanetss around the cervix. It was hard in the study since some of patients did non present themselves on the twenty-four hours of the overview. The study other than utilized a major figure of patients which was a test for the examination specialist. The various patients engaged with this overview had constant cervix strivings ascribed to profoundly various causes. which included physical damages. some uncommon contaminations. what's more, infection diseases among others ( Witt 2004. p. 99 ) . The patients with this activity are all around taken through the three stylostixis treatments. despite the reason for their status ( Hush 2004. p. 1533 ) . The way that all patients are consistently taken into comparative clinical processs without being ordered according to their particular reason for interminable cervix harming stay as the best limiting property of this exploration. Moreover. cut was a limiting element since the clasp took into consideration the examination was non bounty to quickly attempt fundamentally the points of the review. Examination measures and Database usedIn this study. the focuses were gathered through looking for equivalent checked on diary articles and subsequently. the examination laborer comprehensively looked in arranged databases for article that gave data to patients suffering from ceaseless cervix strivings. explicitly those people between the age of 21 and 55 mature ages old. The exploration specialist farther sorted the informations gathered to compose two gatherings of patients of the age section of 21 and 34 mature ages and those somewhere in the range of 35 and 55 mature ages old. The innovative action of these two gatherings was fundamental as taking a more extensive extent of individuals old enough

Experience The Art Paper Essay Example For Students

Experience The Art Paper Essay Angela Brasses Art has a gigantic effect in making our lives perpetually rich. Cant envision, just for a second, a world without workmanship considering the way that craftsmanship have such an impact on structure from our most cherished highlights. Besides, workmanship strengthens unmistakable pieces of our cerebrums to make us snicker or brief us to mayhem, with a whole scope of sentiments in the center. Craftsmanship additionally accommodates us a way to deal with be creative and pass on what necessities be. For certain people, workmanship is the entire explanation they get up toward the beginning of the day. You could state, craftsmanship is something that makes us progressively careful and adjusted individuals. Of course, it is such an extensive bit of our normal lives that we may hardly even Stop to consider. Our shoes could be look as workmanship, just as our attire. General all utilitarian design is craftsmanship. Craftsmanship regularly incorporates correspondence. Apparently, experts need people with whom they can confer their perceptions. Exactly when Art and individuals partner, various possible results rise. As an admirer of the forte of move it has reliably been something gotten a kick out of survey or delighted in as a pre-adult. In demonstrate hatred for tooth affability that move was a brilliant past time I never feel in worship with it until experienced another sign of workmanship called acclaim moving. Recognition Dance is a sort of formal or propound move, it is an indication of move where the consideration is on adoration. Approval move specialists use their bodies to help express the articulation and soul of God Praise Dance is really considered by various spots of love to be a palatable indication of Christian enunciation, just as being consistently used before gatherings to make stimulate and eager conditions. Now and again acclaim move can be a bit of a more noteworthy age wherein an entire story is told. Applause move, instead of various appearances of adoration move, is usually performed to an a lot snappier and fiery music cadence. The artists express the music by waving their arms over their heads, hailing wildly, affecting their bodies, and moving their heads to the music. It can likewise be an understanding Of enjoyment that utilizes the human body to expand, Which are express with both their bodies and their stands up to, lighting up their social occasion of individuals With the pleasure they feel inside their spirits. At the point when commendation move is my quality my body would shudders; while tears job down my eyes, in light of the fact that they were hitting the move floor with such force, and the message they were yielding was convincing. Plus, the performers were serving and revering through move and inviting the group to offer love to the ruler. Recognition move certainly must be the most fantastic basic experience of craftsmanship I have ever felt in light of the fact that it brought me into an other estimation, one where had a supernatural inclusion with a higher power. Along these lines, will consistently sins those minutes, since it was really the most obvious, certified, and most alive experience I have had in my life. Acclaim move is in truth uncommon, excitement and brave. For one self to communicate an unforgiving way to deal with obtain craftsmanship it truly bring out workmanship in unfamiliar spots. Am genuinely persuaded and optimistic that applause move Will draw in people in an incredible enormous type Of craftsmanship, Which would moves, supports and inspires humankind all around the globe.

Short Stories by Selected Women Writers Essay Essays

Short Stories by Selected Women Writers Essay Essays Short Stories by Selected Women Writers Essay Paper Short Stories by Selected Women Writers Essay Paper Article Topic: Poes Short Stories An Undergraduate ThesisPresented to the Faculty of theCollege of Humanistic controls and SciencesUniversity of Southeastern PhilippinesBo. Obrero. Davao City In Partial Fulfillment of the Requirments for the DegreeOf Bachelor of Arts in Literature Cheah Kaye RosalesCharisma J. Tabingo October 2013 AbstractionROSALES. CHEAH KAYE and TABINGO. Appeal J. . College of Southeastern Philippines. Davao City. â€Å"Short Narratives by Selected Women Writers† Counsel: Prof. Dayenne SipacoThis review was led to locate the standard Form of the five short accounts. It is other than broke down the occasions and character’s situation in the story. The Formalistic Approach was utilized in the overview. The study found that the Hagiographas of the five journalists Kerima Polotan Tuvera. Aida Rivera Ford and Irish Shiela Crisostomo show their incredible perception of the Philippine history. This overview was led through the utilization of Formalistic Approach. The exploration laborers assembled each of the five short stories by chose grown-up females writers and read the story. examined and considered. The exploration laborers utilize the formalized assault to examine the signifier of the study. We pick structure for simple to do the development of this overview. Furtheremore. this review examine the components utilized in Kerima Polotan-Tuvera’s The Virgin and A House Full of Daughters. Aida Rivera-Ford’s Love in the Cornhus k and The chieftest Mourner and Iris Shiela G. Crosostomo’s The Steel Brassiere. The section 1 incorporated the activity and its scene. It is other than incorporate the announcement of the activity. the essentialness of the review. range and limitation of the review and meaning of thr components utilized. The part 2 examines the reappraisal of related writing and surveies. the mystery plan summarize and the author’s lifes and the assault utilized in the study. Hypothetical and theoretical model was other than included. In the part 3. the exploration structure. investigate instrument. inquire about technique and research scene are other than remembered for this section. Introduction. investigation and perusing which utilized formalized assault were in section 4. The drumhead. choice and proposal were other than appeared in part 5. The plain arraies of the five short stories are in the indeces incorporating the components utilized in this study. Endorsement SHEET In fractional satisfaction of the requests for the evaluation. Unhitched male of Humanistic teaches in writing. proposition entitled â€Å"Short Narratives by Selected Women Writers† arranged and presented by Cheah Kaye Rosales and Charisma J. Tabingo. is herewith suggested for gift and belief. Prof. Dayenne Sipaco Counsel Endorsed by the Committee on Oral Defense with a class of _______ . DR. Mama. RITA C. TUBAN DR. PATRICIA O. ELBANBUENA Specialist Panelist Acknowledged as incomplete satisfaction of the requests for the evaluation. Single guy of Humanistic teaches in Literature. DR. MILAGROS D. ARQUILLANO DR. EVEYTH P. DELIGERO Director. Night Program Dean. School of Arts and Sciences Acknowledgment The exploration laborers would wish to thank the undermentioned people who helped a group in doing this examination and overview: Prof. Dayenne Sipaco. ourv counsel. much thanks to you for helping us to do and finish this study. much thanks to you for your trepidation. abstinence and horrible judgment. To our board individuals. Dr. Mama. Rita C. Tuban and Dr. Patricia O. Elbanbuena. much thanks to you for your avoidance. understanding and giving us a decent idea in this overview. To our folks. much thanks to you for the help in monetary and moral help. Much obliged to you for the support and petitions. What's more, most especially to our almighty God. much obliged to you for giving us a strenght. counsel. insight and great health to finish this review. C. K. R and C. J. T List of chapters PageDeclaration of Originality †¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦ . . one Title Page †¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦ two Abstract†¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦ three Approval Sheet†¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦ . V Acknowledgment †¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦ . six Table of Contents †¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦ . seven List of Tables †¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚ ¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦ . ten List of Figures †¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦ . eleven Chapter1. THE PROBLEM AND ITS SETTING †¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦ 1 Statement of the Problem †¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦ . . Essentialness of the Study †¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦ . . Extension and Limitation †¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦ . . Meaning of Footings †¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦ . . 2. Audit OF RELATED LITERATURE AND STUDIES Related Literature †¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦ Plot Summary †¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦ Related Studies †¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦ Testimonies on The Virgin †¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦ Testimonies on A House Full of Daughters †¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦ . Declarations on Love in the Cornhusk †¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦ Testimonies on The Chieftest Mourner †¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦ Testimonies on The Steel Brassiere †¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦ Formalistic Approach †¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦ Conceptual Framework †¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦ 3. Technique Research Design †¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦ Research Instrument †¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦ Research Locale †¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Research Procedure †¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦ 4. Introduction. Investigation AND Understanding OF DATA †¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦ . Structure and Content †¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦ . Elementss †¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦ . Likenesses and Differences of the Short Stories †¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦ . . Investigation Data †¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦ . 5. Synopsis. End AND RECOMMENDATION †¦Ã¢â‚¬ ¦ . Rundown †¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦ . End †¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦ . Proposal †¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦ . Informative supplements Informative supplement A TableThe Virgin †¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦ . A House Full of Daughters †¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦ . . Love in the Cornhusk †¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦ . The Chieftest Mourner †¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦ . The Steel Brassiere †¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦ . . The Five Short Narratives The Virgin by Kerima Polotan-Tuvera†¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦ . A House Full of Daughters by Kerime Polotan-Tuvera†¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦ Love in the Cornhusk by Aida Rivera-Ford†¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦ . . The Chieftest Mourner by Aida Rivera Ford†¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦ The Steel Brassiere by Iris Shiela G. Crisostomo†¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦ BIBLIOGRAPHY Educational plan VITAE Rundown OF FIGURESFigure1. 1 Conceptual Framework †¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦ 1. 2 Plot Structure †¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦ Part 1THE PROBLEM AND ITS SETTINGLiterature is the specialty of composed work and can. in certain fortunes. allude completely to print beginnings. The word writing actually implies â€Å"things produced using letters† and the standards professional toto term â€Å"letters† is here and there used to mean â€Å"literature. † as in the figures of address â€Å"arts and letters† and â€Å"man of letters† . A short story is a concise work writing. regularly written in story exposition. In so making. short stories make utilization of mystery plan. reverberation and other powerful co

Obamacare vs. Trumpcare - Free Essay Example

Should Americans have to pay for health insurance? If you are a young adult in todays day and age the first thought that would come to mind would be to say yes. By saying yes you are standing for the Affordable Care Act aka, Obamacare; which includes a requirement called the individual mandate. This is the mandatory health insurance of any and everyone who can afford to pay for it, thus creating money for the ones who can not. By saying no, you are agreeing that healthcare should be individual and that everyone should be held accountable for their own health and health care methods. These two concepts have been widely controversial for the past couple of years, with people disputing which is more unconstitutional than the other. The fact of the matter is that while the ACA may be socially and morally correct to most, it is much more unconstitutional, to say the least. THE AHCA IS SOMETHING THAT CAN CORRECT THE UNCONSTITUTIONAL NATURE OF THE ACA AND CAN HELP BRING JUSTICE, ACTION, AND CHANGE TO TODAYS MEDICAL CRISIS. When the American people think of their own laws and rights, one of the biggest ones is our freedom of choice. If it wasnt for this crucial concept in our society, America as a whole would not be the same, so why is it mandatory to pay for anything, let alone something as expensive as health insurance? Health insurance has always been expensive but because of the requirements in which the ACA demands, insurance is now higher than ever. For the people who decide to opt-out, a penalty fee is given in order to force people to consider getting insurance and to provide insurance coverage for the ones who can not afford it. This is unconstitutional as people are getting a penalty for making more than what is considered enough in the eyes of the law. It also forces people to provide care for people they are not legally obligated to so, in the eyes of the law, this should be deemed wrong while in the eyes of society it can be deemed ethical. This penalty threat in turn ended up backfiring as many people decided to pay the fee instead of getting the actual insurance itself (Potter). 4 million people did this to escape the heavier prices that many insurance companies expect today (Amadeo). This shows that the American people do not see this as something that is just and should be paid for an d would rather go without insurance. Going without insurance is a risk they understand as their own and are held responsible for any payments they may need to make in order to get health care. Listening to our people should be the number one concern and many of them have shown that paying for others insurance is not something they want to be a part of. The law causes many issues, especially for the middle class. The prices alone are enough to heavily affect the lives and spending habits of many American citizens. It is estimated that 3-5 million people lost their health insurance due to it not complying to the Obamacare requirements (Amadeo). This left 3-5 million people lost and on a search to find another provider. This was another reason many people decided to pay the extra fee instead of going through the difficult process to find another insurance company which could, in turn, end up being much more expensive to fit all of the requirements and services that needed to be added to fit the new Obamacare standard. To fund this new plan, the taxes paid for by higher income families, middle-class families, and the health industry rose and created more of a stretch for cash for the middle-class families. Since they make up much of American citizens the economy is struggling to keep up. It also created a rise in health care prices short term due to all of the new parts to the coverage and the increased usage of these services. The ACA has the ability to ruin the economy and can be the difference between adding millions of more dollars to our debt or finally demanding individual responsibility. This is what the AHCA is about as it teaches people to provide for themselves rather than rely on a country that is already trillions of dollars in debt. There are many concerns regarding the AHCA and what it truly entails. Many fear they will lose their health care or will not qualify to receive it. While this is an understandable fear for many, it is not exactly reasonable. AHCA is a law that is very similar to ACA. It still works to provide people with quality health care and insurance but simply thinks that not everyone needs to participate. AHCA still uses many of the positive provisions that were provided through Obamacare, such as the non-discrimination of people with pre-existing conditions applying for insurance (Athar). This is something that was a big concern for many as they did not want to be turned away from insurance companies. The fear for many that are against AHCA is the quantity of health care providers that are available to help more people, what they are not looking at however is the quality of healthcare and how it is diminishing under Obamacare (Sataline). The quality of healthcare is slowly dwindling under the ACA, this is because there is a shortage of doctors willing to work under such conditions. It is estimated that the nation could be facing a shortage of up to 150,000 doctors in the upcoming 15 years, which will, in turn, cause a higher demand for doctors and prices will, again, start to rise. There is also a fear that because there will be such a shortage, that many patients will be turned away to focus on the more serious cases presented (Cusack). This is a problem as it can actually mean that fewer people are being provided with adequate health care and more people will have to find alternative methods of care. Since more people have access to health insurance using the ACA, the misuse of it will also increase creating crowding in ERs, hospitals, and clinics which will further the diminishing quality of healthcare under Obamacare. In conclusion, the ACA provides many with health care and insurance that they may not have been able to receive before. However, this is at the expense of the millions of middle and higher income families and individuals who must pay extra to support the ones who can not support themselves. This causes confusion within the different groups about who should pay what and how much. The ACA has been shown to be unconstitutional due to its lack of regard for the peoples freedom of choice, the strain it puts on huge groups in society, and lack of effectiveness it is having for most Americans. Their efforts to get people to involve themselves in obtaining health insurance have been unsuccessful with many people finding ways around the bigger payments that must be made to the insurance companies. It is also hard on the companies as they are being forced to create plans that suit the Obamacare requirements and many are shutting things down completely. While this plan works in theory, in real life many people are not so care-free with their money and work hard to obtain it in order to pay for the things that they want or need. Regulating what we pay for is going against our basic rights and our freedom of choice and because of that, it is unconstitutional in nature.

Opposing Embryonic Stem Cell Research Essay - 1748 Words

Opposing Embryonic Stem Cell Research Stem cell research has a lot to offer in the way of treatments, or even cures to some devastating diseases that humans face. However, research using human embryonic stem cells that can only be obtained by killing a human embryo can not be condoned or paid for by the United States Government. Federal funding needs to focus on the adult stem cell research that has already been proven successful and can be obtained without destroying a human life. Ethics and morals need to be considered when the destruction of one human life is acceptable so that another human may live. The first thing to differentiate is that it is ethical to experiment on human tissue, but those experiments on human beings are†¦show more content†¦Adult stem cells have already proven to be successful in treating diseases and have helped hundreds of thousands of patients, and new clinical uses expand almost weekly. Adult stem cells can be obtained from cord blood, f at, neural tissue, muscle, bone marrow, placental and skin cells. Adult stem cells are increasingly being shown to have a similar and perhaps an identical capacity to become cells of other types. There is a possibility that adult stem cells may function more efficiently and more safely than embryonic cells. Treena Arinzeh, a young professor who last year won a Presidential Award, the nations highest scientific honor, is bringing the promise of stem cell research one step closer to reality. Adult stem cells also have a unique trait that lends them their magic: Under the right conditions, or given the proper signals, they have the ability to turn into different cell types. Arinzeh is doing exactly that: developing signals, in the form of biomaterials, that will help adult stem cells turn into cells that, if injected into a diseased area of the human body, could regenerate damaged tissue. Her research has also led to two major stem-cell discoveries: One showing that stem cells, when mi xed with biomaterials known as scaffolds, can help regenerate bone growth; and another proving that stem cells taken from one person can be successfully implanted into another. A list of conditions for which stem-cell treatment holds promise grows almost daily: It nowShow MoreRelatedThe Ethics of Stem Cell Research Essay741 Words   |  3 Pages Embryonic stem cell research can be easily defined. A stem is defined as something that is developed from. A cell is defined as a microscopic living organism. According to Dennis Hollinger, Embryonic stem cell research uses from the embryos inner cell mass that give rise to each of the human bodys many different tissue types(1). In our modern day society, stem cell research has become a controversial topic. Several people strongly oppose the idea of the research, but many are struggling forRead MoreFederal Funds Should Be Used for Embryonic Stem Cell Research1401 Words   |  6 Pages Are embryonic stem cells the cure to many of the human body’s ailments, including defective organs and crippling diseases, or is their use a blatant disregard of human rights and the value of life?   Thanks to the rapid advancements in this field, the potential benefits of stem cells are slowly becoming reality.   However, embryonic stem cell research is an extremely divisive topic in the United States thanks to the ethical issues surrounding terminating embryos to harvest the stem cells.   In responseRead MoreA Research Study On Stem Cell Research1324 Words   |  6 Pageslike this. He knows that stem cells could help cure him from his misery, so he has been fighting and fighting for stem cell research to be fully funded in America. Stem cells are cells that have the skill to change into any type of cell in the human body (Lewis). These cells could be put anywhere ill in the body to make it healthy again. Imagine all of the people with chronicle diseases and cancer be ing able to have hope for being happy and healthy again. Also, these stem cells can fix damaged organsRead More Embryonic and Adult Stem Cell Research Essay1359 Words   |  6 PagesEmbryonic and Adult Stem Cell Research With the advent of a wide variety of scientific advances in the medical field, especially those improvements in health-related fields, the quality of life for the earth’s inhabitants has improved greatly over the past century. Scientists continue to improve upon current knowledge and expand the field of medicine. Over the past few years, scientists have performed significant research pertaining to the study of stem cells. Many researchers see potentialRead MoreEmbryo Based Stem Cell Research1171 Words   |  5 PagesEmbryo-based stem cell research The controversy concerning the ethical dilemma related to stem cell research rages on. One particular basis of this controversy emanates from the fact that embryonic stem cells research derives its stem cells from destroyed embryos. Stem cells are cells that are yet to be specialized into specific tissue that serves specific function in the organism. Some radical scientists have labeled these cells the building blocks of future medical and biotechnical research becauseRead MoreThe Medical Promise Of Embryonic Stem Cells1626 Words   |  7 Pagesof Embryonic Stem Cells Why should people suffer from diabetes, Alzheimer’s, sickle cell anemia, leukemia, and plenty of other degenerative diseases while the cure lies in our hands? After James Thompson, a developmental biologist, reported that he had derived the first human embryonic stem cell line (Thomson), the potential of curing degenerative diseases was revealed. Ph.D. holder and deputy director of FDA’s office of Cellular, Tissue and Gene Therapies, Stephanie Simek, explains that stem cellsRead MoreBiomedical Engineering: Stem Cells Essay1584 Words   |  7 Pagesadvances and research that stem from biomedical engineers can solve problems that would have never have been able to be solved before. Engineers have been working on new technology that will utilize stem cells in order to save lives and treat diseases. The stem cells that are used for treatment are called embryonic stem cells. Embryonic stem cells are formed from five-day old human embryos that the embryos are essentially human beings (In Stem-cell Research† Para. 3). The usage of such stem cells has cause dRead More Both Sides of Stem Cell Research Essay889 Words   |  4 PagesStem Cell Research Paper Stem cell research has been quite a controversial topic since its origin in the 1960s by Gopal Das and Joseph Altman. Of course, anything that uses a human embryo would be. Stem cell research could open a vast number of new doors for modern science, it could let us test new drugs, one of which could be the unfound cure for AIDS or Alzheimer’s disease. However, this branch of science comes at a high price, the price of a human life that is only five to six days old (NIH)Read MoreThe Debate Over Stem Cell Research1196 Words   |  5 Pagescontroversy over the topic of stem cell research. It seems to be that the main controversy when it comes to the topic of stem cell research is an ethical debate, and because of this it seems that the side opposing stem cell research always wins due to their use of pathos when it comes to their argument. I personally do not side with those against the idea of stem cell research because I believe that the pros outweigh the cons when you break it down this way. Stem cell research could be the gateway to findingRead MoreThe And The European Union1108 Words   |  5 Pagesprogression of research. The law states that research on embryos older than 14 days is prohibited. Panno Joseph, Ph.D. holder and clinical E.S cell researcher, explains how the age limit of 14 days is specifically used because it is the time period when the brain and spinal cord start to develop, which is the beginning of the neuralization (P anno 32). In addition, the United Kingdom denies the use of embryonic stem cells without a license (Vogel 1602). A license is only obtained for research agencies promoting

Adolescence And Young Adulthood Young Relationships And...

Within current culture, it is easy to assume that young relationships are innocent and do not enable any issues in the adolescents cognitive or physical development. The main concern of Ming Cui et al. is that dating in early adolescence can impede developmental adjustment (Serafini Rye Drysdale, 2013, pg. 253). The reason for this concern is that there is more research showing that there is an association between romantic relationships and delinquency in adolescence and young adulthood (Serafini Rye Drysdale, 2013, pg. 254). Based on personal opinion, there are free factors that support this core reason. The first factor is that young relationships can increase delinquency. There are a few reasons for this assumption to be true.†¦show more content†¦254). Wave one included home interviews of students that went over topics like social and demographic characteristics of respondents, household structure and formation of romantic relationships. Wave two used the same questi ons from the original sample a year later. In 2001, wave three contained the original respondents being interview again about original influences on adolescent hood to adult hood (Serafini Rye Drysdale, 2013, pg. 260). The first measure that if all three waves participated in the topic of delinquency by being specifically involved in damaging property, stealing objects over 50$ or threatening to hurt someone else with a weapon. Wave one specifically answered the question of being in a relationship for the last eighteen months. Other questions asked was what intimacy looked like in relationships like holding hands, kissing or telling their partner is they loved them. The relationships spoken about were seen as romantic relationships since romantic behaviors were involved (Serafini Rye Drysdale, 2013, pg. 260.) Wave three had participants answer how many relationships they have been involved in since Wave one in the last eight-teen months. Results involved delinquency being at its highest in wave one and then it decreased with Wave two and three. 66% of the adolescents reported having romantic relationships in the last eight-teen months since Wave one. The last statistic communicated that the

Gather Togeher In Maya free essay sample

# 8217 ; s Name Essay, Research Paper # 8220 ; A babe # 8217 ; s love for his female parent is likely the sweetest emotion we can savor. # 8221 ; ( Angelou ) By systematically weaving the subject of maternity into her literature, Maya Angelou creates both personal narrations and poems that the reader can associate to. Her geographic expedition of this cosmopolitan subject lends itself to a really big and diverse audience. Throughout Angelou # 8217 ; s plants, she allows her followings to witness her metabolism through different facets of maternity. Well-worked subjects are ever present in Angelou # 8217 ; s works- self- credence, race, work forces, work, separation, gender, and maternity. However, Angelou uses the latter to supply # 8220 ; literary integrity # 8221 ; ( Lupton 7-8 ) . Maya Angelou was born Marguerite Annie Johnson on April 4, 1928, to Vivian Baxter and Bailey Johnson. After three old ages her parents divorced, and both Maya and her older brother Bailey, were sent to Stamps, Arkansas. Once in Stamps, the kids were cared for by their paternal grandma, Mrs. We will write a custom essay sample on Gather Togeher In Maya or any similar topic specifically for you Do Not WasteYour Time HIRE WRITER Only 13.90 / page Annie Henderson ( Neubauer 21 ) . In her first book, I Know Why the Caged Bird Sings, Angelou tells the narrative of her childhood. She besides makes the reader keenly cognizant of her close connexion with her grandma. Stephen Butterfield says of Caged Bird ( in his Black Autobiography in America, 1974 ) : # 8220 ; Continuity is achieved by the contact of female parent and kid, the sense of life engendering life that happens automatically in malice of all confusion- possibly besides because of it. # 8221 ; Annie Henderson is a Devout, independent adult female whose house manus leads Maya throughout many unsmooth musca volitanss in her childhood. It is through Mrs. Henderson # 8217 ; s values of self-government and personal self-respect that Maya # 8217 ; s thought that she is # 8220 ; shit colour # 8221 ; easy fades off ( Vermillion 33 ) . Maya fails to see her grandma # 8217 ; s negative traits. She sees merely a adult female that many people, both white and black, regard. The general shop that Annie owns is the centre of activity in Stamps. This centralisation of the shop has a direct correlativity to the manner Annie is the moral centre of Maya # 8217 ; s childhood household ( Lupton 8-9 ) . After ten old ages of life with Momma Henderson, Maya and Bailey are sent to fall in their female parent in St. Louis. By the clip the kids are in their teens, they hold covered the western part of the United States, going between their parents # 8217 ; separate places and Momma Henderson # 8217 ; s in Arkansas. Each move greets them with a different set of relations or another of their parents # 8217 ; lovers. The convulsion that Maya undergoes causes her to oppugn many facets of herself. As a immature adult female she begins to doubt her sexual penchant and engages in a erstwhile sexual brush to turn out her gender. After this experience, Maya discoveries herself pregnant. Angelou ends her first book with the birth of her boy, Guy. This happening lends itself to a note of rousing that carries through Maya # 8217 ; s following book, Gather Together In My Name. Between the decision of Caged Bird and the beginning of Gather Together, there is practically no interruption in the narrative. The former terminals with Guy # 8217 ; s birth and the latter when he is merely a few months old. In its entirety, Gather Together tells the narrative of Guy # 8217 ; s first three old ages and of Maya # 8217 ; s battle as a immature, individual female parent who is fighting # 8220 ; to accomplish regard, love, and a sense of self- worth. # 8221 ; ( Neubauer 22-23 ) . One of her chief motivations during these early old ages is to trim her boy the insecurity and rejection that Maya faced as a immature kid. However, Maya # 8217 ; s professional calling is besides developing during this clip. Angelou concerns about her duty to care for her immature boy and to supply a stable environment for him ( Lupton 24-25 ) . In her 3rd book, Singin # 8217 ; and Swingin # 8217 ; and Gettin # 8217 ; Merry Like Christmas, Maya discusses her feelings of apprehensiveness and guilt stemming from her go forthing Guy to foster her calling. Despite her internal struggles, Angelou accepts a function as Ruby in Porgy and Bess. After taking on this function, Angelou places Guy in the attention of her female parent. Maya is cognizant of how her actions mirror those of her ain female parent when she was immature ( Lupton 10 ) . While executing with the theatre group, Maya travels throughout Europe, the Middle East, and North Africa. While in Rome, she must cut short her battle because Guy is enduring from her extended leave. She learns that her boy has developed a terrible and apparently untreatable roseola in her absence. After returning to San Francisco, Guy recovers, and together they reach a new degree of trust and mutuality. Simultaneously the two realize that their separation is now over for good ( Neubauer 25 ) . With a promise that recalls the last lines of Gather Together, Angelou vows to Guy: # 8220 ; I swear to you, I # 8217 ; ll neer leave you once more. If I go, you # 8217 ; ll travel with me or I won # 8217 ; t travel # 8221 ; ( Lupton 14 ) . Singin # 8217 ; and Swingin # 8217 ; stopping points in a sentence that stresses, through its three nouns, the underlying subjects of the book: # 8220 ; Although I was non a great vocalist, I was his female parent, and he was my fantastic, dependently independent son. # 8221 ; This sentence non merely works to shut Angelou # 8217 ; s first three books, but besides puts to rest Maya # 8217 ; s feelings of diffidence and insecurities about maternity ( Lupton 14 ) . From the clip Maya was an baby, she had experienced many events which distorted her position on maternity and the function of a # 8220 ; mother. # 8221 ; This skewed perceptual experience created many struggles throughout much of her life. However, by her changeless growth and evolving, Maya was able to get the better of her altered positions and go a loving and devoted female parent, girl, and granddaughter. Gather Together in Maya # 8217 ; s Name Outline I. Introduction II. Background Information III. I Know Why the Caged Bird Sings A. Mrs. Annie Henderson in Stamps B. Move with Vivian Baxter in San Francisco C. Maya # 8217 ; s gestation IV. Gather Together In My Name A. Subject of book B. Maya # 8217 ; s calling and the consequences V. Singin # 8217 ; and Swingin # 8217 ; and Gettin # 8217 ; Merry Like Christmas A. Role in Porgy and Bess B. Absence from Guy while on circuit C. Relationship closing VI. Decision Angelou, Maya. Gather Together In My Name. New York: Random House, 1972. Angelou, Maya. I Know Why The Caged Bird Sings. New York: Random House, 1969. Angelou, Maya. Singin # 8217 ; and Swingin # 8217 ; and Gettin # 8217 ; Merry Like Christmas. New York: Random House, 1976. Lupton, Mary Jane. # 8220 ; Singing the Black Mother: Maya Angelou and Autobiographical Continuity. # 8221 ; Contemporary Literary Criticism, Vol 77. Detroit, MI: Gale Research Inc. , 1993. Neubauer, Carol E. # 8220 ; Maya Angelou: Self and A Song of Freedom in the Southern Tradition. # 8221 ; Contemporary Literary Criticism, Vol 77. Detroit, MI: Gale Research Inc. , 1993. Vermillion, Mary. # 8220 ; Reembodying the Self: Representations of Rape in `Incidents in the Life of a Slave Girl # 8217 ; and `I Know Why the Caged Bird Sings. # 8221 ; Contemporary Literary Criticism. Detroit, MI: Gale Research Inc. , 1993.

West Yorkshire Fire and Rescue Authority

The key ambition of West Yorkshire Fire and Rescue Authority is making its area of operation safer by facilitating efficient, safety measures. The authority responds to fire fighting, floods, traffic accidents, incidents such as lift trapping and those involving hazardous materials such as petroleum, gas, and electricity.Advertising We will write a custom essay sample on West Yorkshire Fire and Rescue Authority specifically for you for only $16.05 $11/page Learn More The authority conducts education on matters relating to fires such as prevention and control to youth groups and schools. It also performs emergency planning, fire safety inspections, and first aid to fire victims. Firefighters and officers frequently visit commercial and residential premises to advice on fire prevention and hazard risk assessment. The central office of West Yorkshire Fire and Rescue Authority coordinates fire prevention tasks in accordance with legislation and support from specialist officers. This paper gives details of the legislation and standards that apply to West Yorkshire Fire and Rescue Authority as a requirement of the Fire and Rescue Services Act of 2004, Fire and Rescue National Framework, and the Regulatory Reform Order of 2005. It also gives an explanation on how the International Organization for Standardization models can be integrated in the authority. In the current economic conditions, public services are experiencing real challenges in supplying efficient and effective services. For purposes of quality assurance, there are several legislative requirements and standards that apply to the authority based on the Fire and Rescue Services Act of 2004. According to the Act, it is the mandate of the fire and rescue authority to make provision with the intention of promoting fire safety in its respective area. In doing so, the authority ought to provide information to the public on the steps that people should take to prevent injury or deat h by fire. In addition, it is the duty of the authority to give advice to the society on how to prevent fires and curb their spread in both private and public premises and ways to get away from buildings and other surroundings in case of fire (The National Archives 2004). The Fire and Rescue National Framework requires for fire and rescue authorities to carry out the task in cooperation with their communities and other partners locally and nationally to deliver their services (Department for Communities and Local Government 2012, p. 7).Advertising Looking for essay on diplomacy? Let's see if we can help you! Get your first paper with 15% OFF Learn More In connection with this, the authority has established a strong partnership arrangement with local communities in regions such as Bradford and Birkenshaw to guarantee service delivery that meets the organization’s statutory duties. The organization is transparent and accountable to the local communities in its dec isions and actions to create the opportunity for communities to help plan for their local service through efficient consultation and involvement. According to the Regulatory Reform Fire Safety Order of 2005, an employer must provide appropriate and comprehensible information to employees. The information should include potential risks at the work place and preventive and protective measures (2005, p. 14). This also applies to any employer employing a child. The information must be provided to the child’s parent or any other person who has parental responsibility over the minor. Moreover, the employer should notify his or her employees of the existence of dangerous substances within the premises and provide them with in depth details about the substance such as the name of the substance, the risks it presents, and legislative provisions concerning the hazardous material. In order to promote efficiency in authority, it is necessary to integrate the quality management principles on which the International Organization of Standardization (ISO) bases its standards. The principles act as a framework, to point the authority towards improved performance. West Yorkshire Fire and Rescue Authority can incorporate the principle of customer focus in its operation through direct involvement and consultations of the community members in its area of operation in planning and making decisions regarding their services. Doing this enables the authority to combine the principles of customer focus and involvement of people. The authority collects and stores data on its daily activities and operations. Accurate and reliable data and efficient analysis of the data will result to realistic and informed decision making. This also ensures that the information is accessible to the people who need it. Processes such as employee training using effective tools, upgrading products and systems, acknowledging employee effort, and establishing goals result to overall advancement in the authority’s performance. Incorporating the system approach management principle is an excellent means to recognition, comprehending, and managing systems. As a result, the authority attains efficiency in achieving its goals (International Organization of Standardization 2012). Since the authority and its suppliers are interdependent, the parties should ensure that the relationship creates value to both. Value can be created by ensuring open communication, establishing joint development activities, and sharing information.Advertising We will write a custom essay sample on West Yorkshire Fire and Rescue Authority specifically for you for only $16.05 $11/page Learn More This paper has discussed the significant legislation and standards that pertain to West Yorkshire Fire and Rescue Authority in accordance with Fire and Rescue Services Act 2004, Fire and Rescue National Framework, and the Regulatory Reform Order 2005. Moreover, the writing has provid ed explanations on how the International Organization for Standardization principles can be integrated in West Yorkshire Fire and Rescue Authority. A combination of these aspects will aid the authority in achieving its goal of making its assigned region safer. List of References Department for Communities and Local Government. (2012) The Fire and Rescue National Framework for England [online]. International Organization of Standardization. (2012) Quality Management Principles [online]. The National Archives. (2004) Fire and Rescue Services Act 2004 [online]. The Regulatory Reform Fire Safety Order 2005. (2005) [online]. This essay on West Yorkshire Fire and Rescue Authority was written and submitted by user Elisabeth Bruce to help you with your own studies. You are free to use it for research and reference purposes in order to write your own paper; however, you must cite it accordingly. You can donate your paper here.

Identification of Human Parechovirus in clinical samples Essays

Identification of Human Parechovirus in clinical samples Essays Identification of Human Parechovirus in clinical samples Essay Identification of Human Parechovirus in clinical samples Essay Introduction The viral genus Parechovirus belongs to the household of Picornaviridae which are non- enveloped, plus strand, RNA viruses. Human Parechovirus and Ljungan virus are the two species belong to this genus. The Ljungan viruses are virus of gnawers, were isolated from bank field mouses in Sweden from a patient infected with myocardial inflammation. It portions similarity with Human Parechoviruses. The Human Parechovirus consists of 14 genotypes: HPeV-1 to HPeV-14. The HPeV-1 undergoes recombination with other strains to bring forth the diverseness in Parechoviruses. The viruses are 7100 to 8500 bases long which are enclosed in an icosahedral mirid bug made up of 60 transcripts each of mirid bug proteins VP1 to VP4. Once the HPeV1 and HPeV2 were known as echovirus 22 and 23 severally. HPeV2 has 87.9 % aminoacid individuality with HPeV1 genotype. Both were foremost stray in1956 during an epidermic of summer diarrhea. The genome has four distant spheres. The 5 untranslated part ( UTR ) precedes a individual unfastened reading frame, towards downstream there is a 3untranslated part and a poly ( A ) tail. The genome encoding a individual protein is processed by many virus encoded enzymes which produces precursors that map in virus reproduction to bring forth protein eventually. Figure 1: The genome of Picorna virus with conventional representation of poly protein in Parecho virus. The peptide covalently bound to 5end. The perpendicular pointers indicate the virus encoded activities for processing proteins. The places of VP0, VP3 and VP1 are indicated as 0, 3, and 1 in the polyprotein severally ( Beginning: Stanway, G.et Al ( 1999 ) Parechoviruses.Journal of Virology, 73, 5249-5254 ) . In general, all Picorna viruses have same basic genomic organisation, but different genotypes show specific features in 5UTR construction, L and 2Aproteins and 3UTR. There exists similarity in 5UTR of Parechovirus with cardio, aphtho viruses which reflects recombinant events occurred in the development of parechoviruses. ( Stanway, G. et Al, ( 1998 ) Molecular analysis of human Parechovirus 2, Journal of General virology, 79,2641-2650 ) The Parechovirus shows assorted responses in host cells. The cleavage of mirid bug protein VP0 seen in other Picorna viruses are non found in Parechovirus. It has a alone extension at N-terminal of mirid bug protein, VP3 and 2A protein which is extremely basic in character. ( Stanway, G. et Al, ( 2000 ) Human parechoviruses- biological science and clinical significance, Reviews in Medical Virology,10,57-69. ) Many recent surveies shown that the Parechoviruses are holding high rate of pathogenicity which causes stomach flu, respiratory unwellness, feverish unwellness, skin eruption, manus, pes and oral cavity disease , sterile meningitis, herpangia. The more prevalence of Parechovirus infections are found in kids less than 3 old ages. Harmonizing to a research done by Miyabi Ito.et Al on clinical stool samples from a random population in Aichi, Japan suggests that the base and aminoacid sequence of Nipponese HPeV-3 was similar to that found in Canada and Netherlands. The survey confirms the world-wide prevalence of Human Parechovirus infection. Besides they concluded that 97 % of patients were younger than 3 old ages old, and among them 86.2 % were under 12 months old. The finding of nucleotide sequence and phyletic analysis of VP1 part and 5UTR part revealed that bulk were holding HPeV1 infection, so comes HPeV3, so HPeV4 and eventually less figure with HPeV6. They besides found some seasonal fluctuation act uponing the clinical manifestation of Parechovirus. HPeV1 detected preponderantly during autumn and winter while HPeV3 instances detected in summer and autumn. They came to a decision that there are differences in mechanism of pathogenesis between HPeV1 and HPeV3 infections. ( Miyabi Ito et Al ( 2010 ) Detection of Human Parecho virus in clinical stool samples in Aichi, Japan, Journal of Clinical Microbiology, 48, 2683-2688 ) Based on the survey of the antigenic belongingss of human Parechoviruses done by Paivi Joki Korpela. et Al, they identified the antigenic site is within VP0 polypeptide. In HPeV1 the antigenisity is in the C-terminal part. The immunological features of HPeV1 mirid bug protein was besides found out utilizing the peptide scanning techniques. ( Korpela, P.J et Al ( 2000 ) Antigenic belongingss of human parechovirus1, Journal of General Virology, 81, 1709-1718 ) Surveies reveal that HPeV infects the cardinal nervous system ( CNS ) in kids associated with terrible neonatal sepsis like unwellness, meningitis or palsy. A group of scientists under the counsel of S.Rangraj has done surveies on HPeV-CNS infection in United States. This was the first multiyear prevalence study of HPeV-CNS infection in United States. They have isolated nucleic acid from cerebrospinal fluid of kids around the Kansas City for 3 old ages 2006 to 2008. HPeV RT-PCR was used and surveies done by sequencing VP3/VP1 junction. They could observe the HPeV in 7 % cerebrospinal fluid samples taken from patients, and the sensing was seasonal from June to October. HPeV3-CNS infection was found in 71 % of male babies. Most common clinical symptoms were sepsis like unwellness ( 66 % ) , crossness ( 98 % ) , fever ( 95 % ) and non-specific roseolas ( 58.6 % ) . ( Rangaraj.S et al ( 2010 ) Human parechovirus3 doing sepsis like unwellness in kids from Midwestern United States, The Ped iatric Infections Disease Journal, www.journals.iww.com ) The prevalence of world-wide pathogenesis shown by Parechovirus is obviously proved by Pham et al by making the research in 362 fecal samples for the sensing of HPeV types in one twelvemonth 2005 to 2006. They have done the survey in many kids who got infected with stomach flu in Srilanka. Out of 362 samples, 30 were positive with HPeV ( 8.3 % ) .The genotypes isolated were HPeV1, 3,4,5,10,11. ( Pham.N.T.K et al ( 2010 ) Human Parechovirus infection in kids hospitalized with acute stomach flu in Srilanka, Journal of clinical microbiology, www.mdlinx.com ) . The viral RNA reproduction composite in HPeV1 septic cells would incorporate the viral protein and membrane changes. The structural alterations in virus septic cells include the Golgi setup decomposition and loss of ribosomes from endoplasmic Reticulum. The viral plus strand RNA and 2C viral proteins were found as bunchs of little cysts in cells. The membrane adhering belongingss of protein 2C resulted in the determination of its presence in Golgi setup and endoplasmic Reticulum. HPeV1 reproduction composite is formed by Golgi marker cysts forms a alone construction among other Picorna viruses. ( Krogerus.C et.al ( 2003 ) Replication composite of human Parechovirus 1, Journal of Virology, 77, 8512-8523 ) In this survey, the clinical sample from a kid with mild diarrhea is taken which is analysed utilizing assorted molecular techniques, in peculiar RT-PCR. The survey included the sensing and analysis of viral RNA, surmising it as HPeV by naming the particular symptoms shown by the patient. The RT-PCR is done by utilizing HPeV specific primers OL993A and OL994A. It is followed by sequencing DNA commercially in both orientations utilizing Gene service.T7 and SP6 RNA polymerase written text induction sites of pGEM ( R ) -T Easy vector is used for this intent. The Analysis of DNA sequence is done farther utilizing Bioinformatics tools. It offers a speedy method of observing Parechovirus and placing which of its genotype is present in the clinical sample. Materials and Methods All the molecular methods were done on the footing of protocol given in Stanway, G. ( 2009 ) Practical Handbook. The RNA being isolated from the clinical sample utilizing commercial kit, QIA A ( R ) viral RNA mini kit produced by Qiagen. The kit works on the rule of selective binding belongingss of silicon oxide gel. ( hypertext transfer protocol: //www1.qiagen.com/products/rnastabilizationpurification/cellviralrnapurificationsystems/qiaampviralrnaminikit.asp ) . The RT-PCR has done along with negative control and marker DNA ( supplied by Invitrogen ) . Two primers OL993A and OL994A were used that are complimentary to the 3end of sense and anti sense strands of DNA, along with RT/PlatinumR Taq polymerase mix. The competent E.coli cells were transformed by utilizing the RT-PCR DNA and pGEM R-T Easy vector. The samples were spread to selective home bases incorporating Luria Bertani Broth. The plasmid DNA isolation was done with commercial kit, Qiagen QIA spin mini column and EcoR1 limitation digestion. The sample was so commercially sequenced utilizing Geneservice. The analysis of DNA sequence has been done with Blast plan ( hypertext transfer protocol: //www.ncbi.nlm.nih.gov/BLAST ) and alignment with Clustalw plan ( hypertext transfer protocol: //www.ebi.ac.uk/tools/clustalw/index.html ) . ( Stanway, G. ( 2009 ) BS934 Practical Handbook- Molecular Medicine Pathway ) Consequence Isolation of RNA from clinical sample: RNA set Deoxyribonucleic acid marker set Figure 2: The Agarose gel cataphoresis exposure of stray RNA sample. The RNA was isolated utilizing Qiagen viral RNA isolation kit. The cataphoresis was done along with DNA marker ( 1kb ladder supplied by Invitrogen ) and visualized the RNA set utilizing gel certification equipment. The RNA stuff was seen as a vilification on the Agarose gel. RT-PCR Deoxyribonucleic acid: Negative Control RT-PCR merchandise Deoxyribonucleic acid Marker Figure 3: The exposure of Ethidium bromide stained RT-PCR DNA after Agarose gel cataphoresis. As per the protocol given in Stanway, G. ( 2009 ) Practical Handbook, the RT-PCR has done along with negative control and marker DNA ( supplied by Invitrogen ) . It is found out that the RT-PCR DNA set has been visualised utilizing gel certification equipment. The presence of set confirmed the presence of HPeV in the clinical sample. There was no set seen in the negative control demoing the echt consequence without any kind of taint. The approximative size of the merchandise is obtained by comparing with the 1kb size criterion DNA marker set. RT-PCR calibrated secret plan for finding the molecular weight of DNA sample: Distance migrated by unknown DNA sample= 37mm Figure 4: The graph between the molecular weight of DNA marker and the distance migrated in the gel cataphoresis. The unknown molecular weight of the RT-PCR sample is calculated from the graph ( fig: 4 ) which was migrated to a distance of 37mm was found to be about 1000 bp ( reverse log 3 ) . Final gel consequence: 1 2 3 4 Figure5: The Agarose gel exposure obtained in 2010 practical. In the fig: 5, the sets were obtained for the RT-PCR DNA and EcoR1cut DNA from white settlement ( Lane 2 and 4 severally ) . There was no set formed for the EcoR1 cut DNA from the blue settlement ( Lane 3 ) . Deoxyribonucleic acid marker RT-PCR Deoxyribonucleic acid from white settlement EcoR1 cut DNA from bluish settlement EcoR1 cut DNA from white settlement Figure 6: The Agarose gel exposure from 2009 practical for comparative survey. The set formed by EcoR1 cut DNA from bluish settlement can be seen. Multiple sequence alliance of DNA sample utilizing Clustalw plan: HPeV1 GAAGATGACACAGAAAATTGCAAACAAACAATGTC-TCCAAATGAACTAGGACTCACTTC 59 HPeV6 GAGGATGATGCTGAAAACTGTAAACAAACAATATC-CCCAAATGAATTGGGTTTAACGTC 59 Consensus -GAATCTGCAGAAGAATGTAAACAGACAATATCACCCAAATGAATTGGGATTAACATC 57 HPeV4 GATGATTGCACTGAAGATTGCAAACAGACTATTTC-CCCAGATGAACTGGGTCTAACTTC 59 HPeV5 GATGATGAAGCTGAGGATTGTAAACAAACTATATC-TCCTGATGAACTAGGTCTTACCTC 59 HPeV2 GAAGATTCAGTAGAAGATTGTAAGCAAACCATTAC-ACCAACAGAATTGGGACTAACCTC 59 HPeV7 GAGGATTGTACTGAGGATTGCAAACAATCTCTATC-CCCAGATGAATTGGGCCTCACATC 59 HPeV8 GAGGATAAAGTCGAAGAATGCAAACAGACATTGTC-CCCAAATGAACTAGGCTTGACATC 59 HPeV3 GAGGACAACATGGAAAATTGTAAACAGTCCATATC-ACCAAATGAATTGGGTTTGACTTC 59 ** ** * ** ** ** * * * ** *** * ** * ** ** HPeV1 AGCCCAAGATGATGGCCCACTTGGTCAAGAAAAGCCAAATTATTTTCTCAATTTTAGGTC 119 HPeV6 AGCACAGGATGATGGACCTCTAGGTGGGGAAAAACCAAATTACTTTCTAAATTTTAGAAC 119 Consensus AGCCCAGGATGATGGACCATTGGGCGATANCAAGCCAAATTATTTCCTAAATTTCAAGTC 117 HPeV4 AGCCCAAGACGATGGTCCTCTGGGAGGTGAAAAGCCAAATTACTTCTTGAATTTTAGAGC 119 HPeV5 AGCACAAGATGATGGGCCCCTTGGAGTAGAGAAACCAAATTATTTTCTAAATTTTAGAGC 119 HPeV2 AGCACAAGATGATGGCCCTTTAGGAAATGACAAACCAAATTATTTTCTTAACTTTAAGTC 119 HPeV7 AGCCCAAGATGATGGACCTCTCGGGTCCGAGAAACCAAATTATTTCTTAAATTTTAGGGC 119 HPeV8 CGCTCAAGATGATGGGCCACTTGGCAATGAAAAACCTAATTACTTCCTCAACTTTAAAGC 119 HPeV3 AGCTCAAGATGATGGGCCTTTGGGTAATGAGAAACCAAATTATTTTTTAAACTTCAGAAC 119 ** ** ** ***** ** * ** ** ** ***** ** * ** ** * * HPeV1 GATGAATGTGGACATTTTTACTGTATCACATACTAAAGTAGATAACCTATTTGGGCGGGC 179 HPeV6 TATGAATGTGGACATTTTCACGGTATCTCATACAAAAGTGGACAATATATTTGGTCGCGC 179 Consensus TATGAATGTAGACATCTTCACTGTTTCCCACACTAAGGTGGACAACTTATTTGGAAGAGC 177 HPeV4 TGTCAATGTTGACATATTTACTGTGAGTCACACTAAAGTAGACAACATCTTTGGTAGGGC 179 HPeV5 AATTAATGTAGATATCTTTACTGTTAGTCATACTAAGGTAGATAACATTTTTGGGCGTGC 179 HPeV2 TATGAATGTTGATATCTTTACTGTCAGTCACACCAAAGTAGACAATATTTTTGGACGTGC 179 HPeV7 AATGGATGTTGATATTTTCACCGCAAGCCACACTAAAGTAGATAACATTTTTGGGCGTGC 179 HPeV8 AATAAATGTGGATATTTTCACAGTGAGCCATACAAAAGTGGATAATATTTTTGGAAGGGC 179 HPeV3 TATGAATGTTGACATTTTTACAGTAAGTCATACCAAAGTTGACAACATCTTTGGTAGAGC 179 * **** ** ** ** ** * ** ** ** ** ** ** * ***** * ** HPeV1 ATGGTTTTTTATGGAGCATACTTTCACCAATGAGGGACAATGGAGAGTGCCATTGGAATT 239 HPeV6 CTGGTTTGTGACAAGCCATGATTTTAACAATGAGGGACAATGGCCCTTAAATTTGACTTT 239 Consensus ATGGTTCTACCAGGAACACACTTTTACAGACGAAGGACAGTGGAGAGTTAATTTGGAGTT 237 HPeV4 ATGGTTTGCATATGATCATACATATAGAGATGAAGGAACCTGGAGGCAGGCTTTGGATTT 239 HPeV5 ATGGTTGGCCCTTGAACACACATTTGCAGATGATGGAACATGGAGGGCAGATTTGAATTT 239 HPeV2 TTGGTTTGCCCATGTTCATGACTTCACTAATGATGGCCTATGGAGACAGGGATTGGAATT 239 HPeV7 CTGGTACAACTCACGGCATGAATTCACAAATGGTGATCTGTGGCGTAGTTCATTGACTTT 239 HPeV8 ATGGTATTCTATGGCTCATGAATTTAGAAATGAAGGTTTGTGGAGGACTAAACTTACTTT 239 HPeV3 TTGGTATGTGACGTCTCATGACTTTAATAATGGAGATACCTGGAGGCAGAAATTAACATT 239 **** ** * * * * *** * ** HPeV1 TCCAAAACAAGGTCATGGGTCCTTATCACTGTTGTTTGCTTATTTTACTGGTGAACTGAA 299 HPeV6 TCCATTTGAAGGTCATGGCTCTTTATCATTATTGTTTGCATATTTCACTGGAGAACTAAA 299 Consensus CCCAAAACAAGGTCATGGTTCACTTTCTCTGCTATTTGCTTATTTCACAGGTGAATTAAA 297 HPeV4 CCCAAAGAAAGGCCATGGTGCCTTAACCCAATTATTTGCCTATTACTCAGGAGAATTAAA 299 HPeV5 TCCCACACAGGGTCATGGTACTCTGACAAGACTCTTCACATATTACTCTGGTGAATTAAA 299 HPeV2 TCCAAAGGAAGGGCACGGTGCCCTATCACTTCTGTTTGCCTACTTTACTGGTGAATTAAA 299 HPeV7 CCCTAAGAAAGGCCATGGGATGCTATCACAACTTTTTGCATATTTTACGGGTGAAGTGAA 299 HPeV8 CCCAAAACAAGGCCACGGTGCACTTTCACAATTTTTTGCTTATTATACTGGAGAGTTAAA 299 HPeV3 TCCAAAAGAGGGTCATGGTATGTTATCACAGTTTTTTGCTTATTTTACAGGAGAAATAAA 299 ** * ** ** ** * * * ** * ** * * ** ** * ** HPeV1 TATCCATGTTCTGTTCCTAAGTGAGAGGGGGTTTCTGAGGGTTGCACACACATATGACAC 359 HPeV6 TATACATGTTCTATTCTTGTCAGGCAAAGGCTTTTTGAGGGTTGTACACACTTATGACAC 359 Consensus CATCCATGTTTTGTTCTTAGCTGGAAAAGGATTTCTTAGAGTAGCTCATACATATGACAC 357 HPeV4 TATACATGTTTTATTCTTGAGTGAAACAGGGTTTCTGAGAGTGGCACATACTTATGACAG 359 HPeV5 TGTGCATGTACTGTATCTTAGTGACAATGGGTTCCTCCGAGTAACTCATGCCTATGACCA 359 HPeV2 CATCCATGTTCTATTTCTTAGTGATAGGGGTTTTCTCAGAGTTGGACATACATATGACAC 359 HPeV7 TATACATATCCTTTATATGGCTGAAAGAGGATTTCTTAGAGTGGCACACTCATATGACAC 359 HPeV8 TATCCATGTACTGTTTTTGTGTGAAAAAGGTTTTCTCAGAGTAGCTCACACATATGACAG 359 HPeV3 TATTCATATCCTATATATGGCAAAGCAGGGGTTCCTTAGAGTGGCTCATACATATGACAC 359 * *** * * * * ** ** * * ** ** * ****** HPeV1 TAGTAATGATCGAGTCAATTTTCTGTCATCGAACGGTGTAATAACTGTACCAGCCGGAGA 419 HPeV6 TGCTGATAATAGATTAACTAACTTGGCCTCTAATGGCGTGATCACCATACCAGCTGGAGA 419 Consensus ATCAGAAAATAGAGTTAACTTCTTGTCATCTAATGGTGTTATCACAATCCCAGCGGGAGA 417 HPeV4 TGATACAAACAGGTCTGACTTCTTCTCTTCAAACGGCGTCATCACTGTGCCCGCAGGGGA 419 HPeV5 TGATAATGACAGATCCAACTTTTTGTCATCCAATGGAGTAATTACAGTGCCAGCAGGTGA 419 HPeV2 TGAGACAAACAGAACCAATTTTTTATCATCCAGTGGCATAATTACAGTACCAGCAGGAGA 419 HPeV7 TGAGACACAGAGGGATGACTTTCTATCATCAAATGGTGTGATAACAATACCAGCTGGAGA 419 HPeV8 TGATGAGGGGCGAGATGACTTCTTGTCATCCAATGGAGTCATTACCATACCAGCTGGAGA 419 HPeV3 TGAAGATAATAGGAAAACTTTCTTGTCTTCAAATGGGGTAATAACTATCCCTGCTGGTGA 419 * * * ** * ** * ** ** * ** ** ** ** HPeV1 GCAGATGACACTTTCAGCTCCCTACTATTCAAACAAACCATTAAGAACTGTCAGAGATAA 479 HPeV6 ACAAATGTCATTATCAGCCCCTTTCTATTCTCACAAGCCATTGAGGACGGTTAGGGACAC 479 Consensus ACAAATGACATTATCTGCACCTTACTACTCAAATAAACCCCTTAGGACAGTTAGGGACAG 477 HPeV4 ACAAATGACCCTGTCAGTACCATTCTACTCTTCAAAGCCCTTGAGGACAATCAGGGATTC 479 HPeV5 ACAGATGACGCTTTCTGTGCCATTCTATTCTTCTAAACCACTTAGAACAATAAGAGAAAC 479 HPeV2 ACAGATGACACTATCTGTCCCCTCTTATTCCAACAAGCCATTACGGACAGTTAGATCATC 479 HPeV7 ACAAATGACTTTATCTGTACCATACTACTCAAATAAACCATTGAGGACTATAAGACATGA 479 HPeV8 GCAAATGTCTCTATCTGCTCCATTCTACTCACACAGGCCATTGAGAACAATTCGCAATGA 479 HPeV3 GCAGATGACACTCTCAGTACCTTTTTATTCAAACAAGCCTCTGAGGACAGTGCGCCATGA 479 ** *** * * ** * ** * ** ** * ** * * ** * * HPeV1 CAATAGTCTTGGTTATTTGATGTGCAAGCCCTTCTTGACTGGAACCTCTACTGGTAAAAT 539 HPeV6 TCACAGCTTGGGTAGGCTTATTTGCAAACCATTCCTGACTGGAACAACATCTGGCAGGAT 539 Consensus CAATAGTCTTGGGTATCTGATGTGCAAGCCATTCCTCACTGGAACAACAACAGGGAAAAT 537 HPeV4 AGCTGCTCTAGGGTATGTGATGTGTAAACCATTCATGTCTGGGACAACAGGTGGAAAGAT 539 HPeV5 TGGTGCATTAGGCAAATTAATCTGTAAACCATTGTTGTCTGGCACACATTCAGGGAAGAT 539 HPeV2 CAATGCTTTAGGTTATTTACTGTGTAAACCATTGCTAACTGGTACCAGCTCTGGTAGAAT 539 HPeV7 ATCAGCACTTGGTTTCTTGTTGTGTCAACCACTTTTATCAGGTACAGACAGGACTATTGC 539 HPeV8 GGATGCATTAGGATATTTACTATGTCAACCTATGCTTACAGGAACATCAAGTGGCAAGAT 539 HPeV3 TTCAGCATTAGGTTTTCTTATGTGTAGACCATCGATGCACGGGACTACACGAACTACTGT 539 * ** * * ** ** * ** ** * HPeV1 TGAGGTTTATCTTAGCCTGAGATGTCCAAATTTCTTTTTCCCTCTTCCTGCCCCTAAGGT 599 HPeV6 AGAAGTATATATGAGTCTCAGGTGCCCAAATTTCTTCTTTCCTGTTCCAGCACCAAAAAA 599 Consensus AGAGGTCTACCTTAGCCTGAGGTGTCCAAATTTCTTCTTTCCTCTCCCCGCGCCTAAAGT 597 HPeV4 AGAGATATATCTGAGTTTAAGATGTCCAAACCTATTCTTTCCCTTACCAGCTCCGAAACC 599 HPeV5 CGAAGTTTATTTGAGTCTCAGATGCCCTAATCTATTCTTTCCTTCTCCTGCACCTAAAGA 599 HPeV2 AGAGATATTCCTTAGCTTGAGATGTCCAAATTTCTTCTTTCCCTTACCAGCACCAAAACC 599 HPeV7 AGAAGTATATATTAGCTTAAGGTGTCCAAACTTTTTCTTTCCAGCGCCAGCACCTAGACC 599 HPeV8 TGAGGTGTATCTCAGCTTGAGGTGTCCAAATCTGTTTTTTCCAATCCCAGCACCTAAGCC 599 HPeV3 AGAAGTTTATGTTAGTTTAAGGTGCCCCAATTTCTTTTTCCCTGTACCAGCTCCTAAACC 599 ** * * * ** * ** ** ** ** * ** ** ** ** ** ** * HPeV1 TAC -G -AGTAGTCGTGCACTACGGGGTGATATGGCAAACCTTACAAATCA 647 HPeV6 CACACCACGCTCG -CAAAGTCGTGCTCTACGAGGTGATATGGCTAATTTGACAAATCA 656 Consensus AAC -A -ACTGGTCGTACTTTGCGGGGTGACTTGGCAAATTTCTCAAACCA 645 HPeV4 TGC -A -ACTAGTCGTGCTTTGCGGGGTGACATGGCAAACTTCTCAGACCA 647 HPeV5 GAA -A -ACTTCCAGAGCTTTGCGGGGTGACTTGGCAAATTTTATAGATCA 647 HPeV2 AGC -AACACGTAAATATAGAGGAGATTTGGCAACATGGTCTGACCA 644 HPeV7 AATTAATACTACA -CCAATAGGC -TACAGTAACGAAAGCCCATATGGTCAAGAACA 653 HPeV8 TGCCAATGCATTAAGGTCACTCAACCCATTTAGTGATGAAAGTCCATATG -AAGCACC 656 HPeV3 AACTGGTTCAAGG GCTACAGCAC TTTCTGATGAG 633 ** HPeV1 G 648 HPeV6 G 657 Consensus HPeV4 G 648 HPeV5 G 648 HPeV2 A 645 HPeV7 AGTGACAAC 662 HPeV8 AAT 659 HPeV3 Discussion: I have started the experiment with an premise of HPeV virus infected the kid demoing mild diarrhea. The isolation of viral genome from the clinical sample utilizing Qiagen kit ( rule: selective binding belongingss of silicon oxide gel ) and Agarose gel cataphoresis proved that the viral genome was RNA. From analyzing the Agarose gel photographic image it clearly showed that the RNA isolation was successful ( Fig: 2 ) . From the gel photographic image of RT-PCR ( Fig:3 ) , we can presume that the PCR merchandise DNA is holding a molecular weight closer to that of 1018bp in the marker DNA. By plotting the graph between the molecular weight of DNA marker with the distance migrated in the gel ( Fig:4 ) , I could turn out the approximate molecular weight of DNA sample after PCR which is closer to the false value got from gel cataphoresis. The sequences which are complimentary to the primers used were selected as primer binding sites inorder to magnify under specific thermic rhythms. The absence of set in the negative control shows the RT- PCR done was right without any taint. The RT-PCR has helped to uncover speedy DNA elaboration which is advantageous over traditional PCR. It besides collects informations in the exponential growing stage whereas traditional PCR is measured at the terminal point. The cloning of PCR merchandise done utilizing pGEM R -T easy vectors which contain T7 and SP6 RNA polymerase boosters. A group of scientist under Smeekens.S.P has done their survey on T7 booster sequence. T7 RNA polymerase which has specific adhering belongingss with T7 boosters determines the reproduction of bacteriophage. The booster specific binding was shown to be insensitive to fluctuation in the ionic strength of incubation solution but found sensitive to DNA spiral. The efficiency of polymerase-promoter unfastened composites are determination factors of written text. ( Smeekens.S.P et.al ( 1986 ) Promoter and nonspecific DNA binding by T7 RNA polymerase, Oxford diary on Nucleic acids Research,14,2811-2827 ) The chief intent of utilizing the pGEM R -T easy vector is that, it is holding multiple cloning parts. It has ampicillin opposition cistron which would do the host cell to last in Principen rich medium. There are EcoR1 limitation enzyme acknowledgment sites on both sides of ligated RT-PCR merchandise in the vector. Thus the plasmid isolation after the Transformation is done utilizing EcoR1 enzymes. The enzyme DNA ligase ligated the RT-PCR merchandise into vector. The Deoxyribonucleic acid with the vector is transformed into competent E.coli cells. The inability of E.coli to accept DNA leads to do it competent utilizing CaCl2. If the whole procedure was successful we would hold got bluish and white settlements of cloned cells in the LB stock home bases. But the bluish settlements were non able to separate decently in the thick of other ampicillin sensitive settlements. The ground for the complete growing of unwanted settlements might be due to the low concentration of Ampicillin added as experimental mistake. Thus the Principen sensitive cells besides multiplied along with cells incorporating vector and cistron of involvement. As a consequence there was no set produced in the Agarose gel cataphoresis from the bluish settlement cells. The plasmid DNA isolated from the cloned cell was used for sequencing on both orientations without the separation of fragment. The Deoxyribonucleic acid sequence is analysed utilizing the package plan. The finding of direct or indirect orientation of DNA sequence is done utilizing Blast nucleotide hunts. The T7 belonged to human parechovirus1 ( length7380 ) was direct orientation with +/+ strand while SP6 belonged to human parechovirus1 ( length 7380 ) was found to be indirect with +/- strands. The contrary compliment for SP6 was taken and the alliance done utilizing Clustalw. Then with different HPeV type sequences the consensus sequences are compared utilizing Clustalw. By analyzing the sequences and phyletic tree the sequence isolated from clinical sample has similar hereditary beginning with HPeV1 type Parechovirus. Hence it is identified that the kid is infected with Parechovirus type1 infection. Recognition: I would wish to widen my sincere gratitude to Professor Glen Stanway, University of Essex, for his support and counsel for my practical work. I am besides widening my thanks to Ms. Maysoon, PhD pupil for her support during the practical work.

Case Study Example | Topics and Well Written Essays - 500 words - 20

Case Study Example Created in the contract were a series of award fees eligible to Textron at the end of each of the performance period based on its performance during that period. However, the decision as to the amount that Textron would receive and if so how much was left to the discretion of the Fee Determining Official ("FDO") based on the FDOs assessment of Textrons performance in several specified areas. It was a struggle funding the project, since from summer of 1985 up to the end of 1987 Textrons expenditures under the contract exceeded the allocated funding. Even before the award of the contract, the contracting officer made it clear to Textron that there was a possibility of the SDI[O] stopping the funding of EMRLD. The problem became worse in 1987 when both SDIO and Air Force stopped funding the project. After completing its close up work, Textron on December 19, 1990 submitted a termination settlement proposal to the government requesting $13,428,348 over and above the $113,479,301 paid to date under the contract. The CPAF contract called for a zero base fee and an as award fee not subject to the Termination or disputes clauses as to the payment and amount of the award fee. During the course of the contract, the contracting officer repeatedly reminded Textron that the LOF clause in the contract remained in effect. The language of the contract did not allow Textron to receive any extra amount after the termination b of the contract. According to the court’s rationale, Textron failed to prove beyond any reasonable doubt that it was in deed eligible for the extra payment. According to the language of the contract, the court ruled in favor of the government. Since Textron was aware of the likelihood of the government stopping the funding of the project, and as expressed in the contract that there would be no award of the termination fee, then the court ruled in

MGT302 - Org. Behavior and Teamwork CA Essay Example | Topics and Well Written Essays - 750 words - 1

MGT302 - Org. Behavior and Teamwork CA - Essay Example Unfortunately, it takes a certain mix of educated thought processes and considerations to be able to make the best decision that would apply to a given situation. The article entitled, â€Å"Herb’s Concoction (and Martha’s Dilemma): The Case of the Deadly Fertilizer,† Customer Affairs Department personnel Martha Wang needs to decide on how to handle information from a customer complaint claiming that the best-selling product of their company, Herb’s Garden, allegedly caused the death of the customer’s animal. Thus, Martha needs to make what is called a non-programmed decision. Non-programmed decisions are so unique and important that they require conscious thinking, information gathering, and careful consideration of alternatives. This is in contrast with programmed decisions which occur frequently enough that one already develops an automated response to them. . Martha faces quite a dilemma in this case. First, she herself has had a previous experience that is similar to the issue being raised by the customer. However, when she addressed this issue to upper management, it was simply dismissed as being a case of an overreacting customer. Furthermore, the company’s owner personally requested Martha to take care of the situation. in such a crucial situation, individuals may be overwhelmed by the pressure that they face. Therefore, Martha must carefully analyze the situation and weigh all alternatives to come up with the best option. Furthermore, in turning decision making into a more manageable affair, Bauer and Erdogan (2005) suggest that one asks the following questions: For Martha, the necessary first step would be to do some background research. She could try to look into the company’s history in terms of customer feedback, especially concerning the particular product which is Herb’s Special Fertilizer Mix. If she feels that there is indeed sufficient customer complaints similar to the one brought up by the client that

Health and Social Care Essay Example for Free

Health and Social Care Essay Our campaign was a drugs campaign our main aim was to inform people on drugs and what effects it can have and to not stereotype drug users as they can be anyone. M2- Positive influences I felt our group were very well prepared as we had a good use of resources. This included plenty of leaflets to give out on drugs to inform people on the effectiveness on drugs. We also had a laptop with the Talk to Frank game on it available for people to play, and other drugs game activities that were available for people to take part in. We also gave out questionnaires and cakes which rewarded those for taking part. We also had plenty of space to set up the table and all the activities. This was important as not having enough space would have meant not being able to set up all the activities we made. We also, had plenty of time as we had a good time slot of 2 hours between 11 – 1 to implement the campaign. This gave more time for us to hand out questionnaires and inform and teach more people on the effects of drugs. We all took part equally in the campaign as we were involved in the stereotyping activity where we all attached signs to us asking â€Å"do you think I take drugs? where we asked people with regarding what we looked to like to whether we took drugs or not. Read more: Identify ways of working that can help improve partnership working  essay This involved us dressing up in particular clothes which seemed to be very effective rather than showing pictures of people. I believe we also taught lots to people as many people were shocked at the information gave to them especially about the â€Å"legal highs activity†. Negative influences I felt we didn’t all equally participate in preparation as the questionnaire and research I made were not used and a different questionnaire was made. This in effect made it seem as if my contribution was not necessary. I also, felt that I didn’t take part in setting up the campaign as the presentation tasks went to other group members. However, the campaign involved dressing up as characters and I believe that we all did a good job of dressing up except certain members of the group didn’t dress up as they should of as originally, we had the plan of someone dressing up in a suit to show that your appearance doesn’t affect whether taking drugs or not. This was important as not only were we raising awareness we were teaching about tereotypes. Also, the people that came to the campaign didn’t engage in all activities as we hoped as there was so many to take part in and so much information to give out. Also, our target audience were teenagers as there was evidence most drug users were around this age However, mostly adults came. I felt we had a limited audience and not as many people as we thought came to the campaign and a lot of the people had learning disabilities in which we weren’t prepared for and didn’t cater for. M3 – Ethical issues One of the main ethical issues in our campaign was confidentiality.  Confidentiality is important as during the campaign someone may come forwards and confide in you about drugs or there drug intake and it is important that confidentiality is not breached and that person’s name is not discussed and their privacy is kept. As we gave out questionnaires, they were kept anonymous so therefore, all information received from the campaign can be kept confidential as one of the questions was â€Å"Do you know anyone that takes drugs† which although this was a closed question it was quite personal and anyone answering might of felt uncomfortable if the questionnaire was to ask your name. This then links to safe guarding. During the campaign no one came forward with any information that could of lead them to be unsafe However, it was important that information we gave out was correct and that we weren’t giving false information which could lead someone to danger when taking drugs. This I felt we did successfully as all research given out was from drug websites such as Talk to Frank. Also, other ethical issues include choice and own beliefs. I believe that when giving out information we didn’t preach any of our own beliefs to anyone. It was completely factual. As this could of lead someone to feel uncomfortable as everybody has the right to choose whether they take drugs or not and if it is important that when teaching that you are not preaching your beliefs about people taking drugs as this could lead to offending someone who is taking them. Finally, it is important to not ask any inappropriate questions as this could lead to someone feeling uncomfortable. All personal questions that needed to be asked during our campaign were on an anonymous questionnaire which didn’t involve any questioning from anybody from our group. Therefore, making people feel comfortable in answering. Other questions asked by us were â€Å"do you think I look like the type of person that takes drugs? † as we were dressed up as characters. However, this question was asked after we explained that we were dressed up as characters as part of the campaign so people felt comfortable in answering without offending. Also, the question â€Å"would you like a cake? † for those who didn’t want to take part in any of the activities. D2 – During our campaign we gave out questionnaires after people took part in the activities. However, only 32 people answered the questionnaire. According to the questionnaire 22 people out of 32 knew someone who takes drugs that left only ten people who didn’t know anyone who took drugs. According to the Shropshire star â€Å"16 local Shrewsbury men had a powerful and overbearing’ influence on others in the drugs chain and was said to be taking ? 15,000 a month from the trade. † â€Å"Phoenix Car centre was aware of the extent of drugs operation and played significant part in getting drugs to the street of Shrewsbury under orders from other people. Some of these men are parents to teenagers in Shrewsbury and therefore, it is possible that some of the people that filled out the questionnaire knew these men. http://www. shropshirestar. com/news/2013/03/03/how-police-smashed-shropshire-drugs-cartel/ Also, 28 out of 32 people were made more aware of the effects of drugs after the campaign whereas only 4 people didn’t. This could of meant that they already knew about the effects drugs had on someone or they didn’t feel out campaign gave much information on the effects drugs have one someone. However, more than three quarters did find out more about the effects of drugs which is positive. This could suggest that existing campaigns aren’t using the correct technique as we did to inform people on the effects of drugs. Talk to Frank is a website that only offers online information and a call centre in which people are able to access to talk about drugs. However, although our campaign used most of the Talk to Frank information we implemented it in a different way which was more effective to informing people on the effects of drugs. â€Å"Since 2011 the Talk to Frank website has had a 6% increase in feedback† Therefore, It could suggest that people are using the website a lot more than previously. This could be why some people didn’t learn anymore about the effects of drugs and as our campaign was implemented directly through explaining we were able to teach more people about the effects. http://www. clear-uk. org/talk-to-frank-is-back/ 29 out of 32 people found out more information about drugs after the campaign was implemented. This meant that only 3 people didn’t learn anything from the campaign. This could have meant that they already knew or that our campaign wasn’t very informative. However 29 people did find it informative, which is more than 3 quarters of the people that were involved. Therefore, I feel as though our campaign did inform people well. Also, when questioned how useful the campaign was statistics show that 19 people thought our campaign was really good 11 people thought it was good and only 2 people thought it was average. And nobody felt our campaign was poor or really poor. Therefore, more than half thought out campaign was really good and useful and the rest thought it was good or average. This is positive results. Overall, our campaign results are very positive. This means that our campaign was very beneficial. I feel that our campaign went really well due to the positive feedback that we got of the audience. This is proved with results from our questionnaire which we gave to the audience to get their personal opinions on how well our campaign was to them. When giving out the questionnaire I felt we were present and observant when the questionnaire was filled out. Therefore, I feel that the results we got back from the questionnaire may be slightly warped due to people not wanting to be judged or questioned about their answers if they were negative as although it was anonymous it was very overt. Other campaigns use the questionnaire online and get feedback from the public, such as the Talk to Frank website and if I were to do the campaign again I would allow people to step aside to fill in their questionnaire and ask them to put it into a box I feel this covert way of gathering information is much better as it gives the public privacy which makes them able to write down their real thoughts and opinions about the campaign and not put answers to be polite. However, I felt our campaign nformation was as good as Talk to Frank as we had the talk to Frank games available and we were able to use a good range of information from the Talk to Frank website to bring awareness about the effects of drugs. http://www. talktofrank. com/? gclid=CLf-1dOy6bcCFQ3KtAod_Q4AnA A National campaign launched by the Australian government in 2011-2012 also used public speaking and posters to communicate to the public about the awareness of drugs and it was also very effective for them. They also collected results from their campaign on how it affected certain people and how it has made a difference for these certain people, how they’ve become more aware of drugs and the dangers, how they now feel about drugs and if they would ever attempt to take drugs. Which is slightly different from our campaign questionnaire but it is still the same method of gathering information and still very similar to the way in which we implemented our campaign. http://www. drugs. health. gov. au/internet/drugs/publishing. sf/content/campaign4 This proved very good in some aspects as there has been an increase in showing that drugs are harmful and helping people avoid using drugs which is very similar to our campaign in the fact it is bringing awareness by showing that drugs are bad and harmful by looking and there effects. Also, other statistics show that more adults are talking more to their children about substances after the campaign which again is bringing awareness and also p romote two way communications.

Phaedo Summary Essay -- essays research papers

Phaedo Summary   Ã‚  Ã‚  Ã‚  Ã‚  Socrates stands now before his disciples telling them he is not afraid of dying because he says death is what the true philosopher waits for all his life. The philosopher must have lived a good life, and when death is presented upon him, he should take the opportunity. Socrates formed a conclusion that: â€Å"That the real philosopher has reason to be of good cheer when he is about to die, and after death he may hope to obtain the greatest good of the world.† Socrates is saying that when death is presented upon him, he should have no reason but to be happy, and when that death comes; he will have achieved the best gift in the world.   Ã‚  Ã‚  Ã‚  Ã‚  Socrates states evidence of why he is not afraid of dying through multiple mini-conclusions. Socrates says to Simmias, â€Å"Why when his time comes should he repine at which he has always been pursuing and desiring?† Socrates is saying why should philosophers grieve at death when that should be the goal of their whole lives. He believes only philosophers can understand because he believes philosophers will be truly alive after death, and normal men will just die. Normal men do not know that true philosophers have always been pursuing death and dying, and the desire of death has been with them all their lives.  Ã‚  Ã‚  Ã‚  Ã‚     Ã‚  Ã‚  Ã‚  Ã‚  Through out his whole testimony, Socrates states questions to his disciples already knowing the answers, but he...

Foreign Policy 1776-1807 Dbq

During the Washington, Adams, and the Jefferson administrations, the United States was thrust into the decision of joining either Britain or France, the two most powerful European nations. In determining the effects of foreign policy on the developing nation, one must establish the overall direction of the United States took. As a budding nation, George Washington proposed the idea of neutrality in order for the country to have no involvement in European affairs. However, Federalists and Democratic Republicans were outraged by this decision since the Federalists supported the British while the Democratic Republicans supported the French. Neutrality also allowed the United States to temporarily smooth its relations with Europe because of commercial interest. Therefore, neutrality, instead of siding with either Britain or France or through their commercial interests, was the obvious direction taken by foreign policy. After witnessing and being involved in uncontrollable European affairs, the growing nation of the United States concluded that an international policy of neutrality would be the best option in the area of foreign affairs. During his presidency, Washington decided that it was best for America to stay neutral. As stated in his Proclamation of Neutrality that any American providing assistance to any country at war would be punished with legal proceedings (D). He was aware of the possible dangers that would occur when allying with a certain country. The country was too new to enter any wars or deal with wars of foreign countries. â€Å"Europe has a set of primary interests†¦Hence she must be engaged in frequent controversies, the causes of which are essentially foreign to our concerns† (J). Even in his farewell address, Washington advised the fledgling nation to not get involved in European affairs or make permanent alliances, to avoid sectionalism, and to not form political parties. After Washington resigned from office, John Adams tried to maintain the position of neutrality as the second president of the United States. He did as much as he could in avoiding war with France. Even before his presidency, in response to a proposed alliance with France, he argued that â€Å"†¦we ought not to enter into any Alliance with her [France], which should entangle Us in any future wars in Europe, that We ought to lay it down as a first principle and a Maxim never to be forgotten, to maintain an entire Neutrality in all future European Wars† (A). However, after the XYZ Affair, in which French agents demanded a large bribe for the restoration of diplomatic relations with the United States, a Quasi War erupted between France and America. The Convention of 1800, also known as the Treaty of Mortefontaine, was a treaty between the United States and France to settle the hostilities that erupted during that war (I). When Thomas Jefferson became president, it was a peaceful transition from Federalist to Democratic Republican. Despite the differences between these political parties, Jefferson also tried to maintain Washington’s idea of neutrality. In his Inaugural Address in 1801, he states â€Å"We are all Republicans, we are all Federalists† and that there would be â€Å"Equal and exact justice to all men, friendship with all nations, entangling alliances with none†¦Ã¢â‚¬  (K). Even as a last resort to the Louisiana Purchase, he told Monroe to make an alliance with Great Britain if the Louisiana Purchase did not work out. In all three of their presidencies, Washington, Adams, and Jefferson decided that it was best for the new nation to enter a state of neutrality. Despite its neutrality and unwillingness to enter war with the European nations, the United States were being forced to side with either Great Britain or France, Europe’s most powerful nations. During Washington’s presidency, the revolutionary government of France sent diplomat Edmond-Charles Genet, also known as Citizen Genet, to America to propagandize the case for France in the French war against Great Britain, which created the network of Democratic Republicans. Washington demanded the French government recall Genet, and denounced the societies. The United States were in a conflict with Britain, as the British were seizing American ships and impressing sailors. Hamilton and Washington designed the Jay’s Treaty to normalize trade relations with Britain, remove them from western forts, and resolve financial debts left over from the Revolution (F). John Jay negotiated and signed the treaty in 1794. However, many disputes rose from this decision. James Madison criticized that the treaty stated to open West India ports to the United States, yet Britain refused to follow these regulations (G). During Adam’s presidency, the XYZ Affair, which was supposed to have been the negotiation between America and France on the seizure of American ships, threw the United States into a Quasi War with the French. In the aftermath of the undeclared naval war with France, the Alien and Sedition Acts were passed, which allowed the president to deport hostile aliens, increased residency requirements for citizenship, and banned criticism of government policies or officials. After the United States’ conflict with France, Jefferson, a Democratic Republican, considered the possibility of an alliance with Britain. While Britain and France were both seizing American ships, Britain had the strongest navy and was thus able to force the American sailors into its navy (M). Jefferson believed that this conflict would cease if the United States agreed to establish an alliance with Britain. Torn between the conflict of siding with either France or Britain, the United States agreed to remain neutral. Although neutrality in the new nation was favored, there was a possibility of joining either Britain or France depending on which one was more financially beneficial. After Jay’s Treaty, which was signed with Great Britain during Washington’s presidency, Spain did not want the United States to side with the British and wanted to smooth its relations with the fledgling country. Pinckney’s Treaty, signed on October 27, 1795, established the intentions of friendship between the United States and Spain. The treaty also granted the States use of the Mississippi and right of deposit at New Orleans (H). In the Treaty of Paris in 1783, â€Å"It is agreed that the people of the United States shall continue to enjoy unmolested the right to take fish of every kind on the Grand Bank†¦Ã¢â‚¬  and that â€Å"The navigation of the river Mississippi, from its source to the ocean, shall forever remain free and open to the subjects of Great Britain and the citizens of the United States† (E). Thomas Paine stated that commerce would secure the friendship with Europe because Europe wants America to have a free port (B). Jefferson, fearing the power of the neighboring French in the Louisiana Territory, sent Monroe to Paris to negotiate the purchase in 1802. Their interest was only in the port and its environs. They did not anticipate the much larger transfer of territory that would follow. The purchase greatly benefited the United States because it granted them access to the entire Mississippi River. Also, as a result of impressments of American sailors, Jefferson established the Embargo Act of 1807, also known as the Nonintercourse Acts, restricting American ships from engaging in foreign trade between the years 1807 to 1812. Jefferson believed that without trade with the United States, Britain and France would fall into an economic crisis. However, the Europeans nations did not bother with America and traded with other countries, causing the new nation’s economy to fall. This outraged the general public, and when Jefferson left office, these acts were repealed. Commercial interest helped the United States to choose between siding with either of the European nations or remaining neutral. Throughout the Washington, Adams, and Jefferson administrations, Britain and France tried to force the United States into allying with either of the two nations. Although it was tough to maintain, neutrality was established in the country by Washington. The decision brought various problems for the budding nation, but it still stayed strong.